Incidental Mutation 'R4500:Olfr298'
ID331783
Institutional Source Beutler Lab
Gene Symbol Olfr298
Ensembl Gene ENSMUSG00000062878
Gene Nameolfactory receptor 298
SynonymsGA_x6K02T2NHDJ-9619796-9620794, MOR219-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4500 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86486322-86492484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86488919 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 211 (C211S)
Ref Sequence ENSEMBL: ENSMUSP00000150228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077800] [ENSMUST00000213223] [ENSMUST00000216968] [ENSMUST00000217110]
Predicted Effect probably benign
Transcript: ENSMUST00000077800
AA Change: C211S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000076973
Gene: ENSMUSG00000062878
AA Change: C211S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 4.2e-37 PFAM
Pfam:7tm_1 39 288 8.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213223
AA Change: C211S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000216968
AA Change: C211S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000217110
AA Change: C211S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T A 16: 88,759,541 C214* probably null Het
4931409K22Rik T C 5: 24,548,277 D459G possibly damaging Het
Ap3s1 T C 18: 46,790,000 V186A possibly damaging Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dpep2 T C 8: 105,985,482 E282G probably benign Het
Fam83d A G 2: 158,785,267 E292G probably benign Het
Gm4981 C T 10: 58,235,706 A229T possibly damaging Het
Hook1 T C 4: 95,993,200 probably null Het
Klhl18 C T 9: 110,429,966 G445S probably damaging Het
Olfr644 A G 7: 104,068,195 S279P probably damaging Het
Pias3 C T 3: 96,701,418 R259W probably damaging Het
Prr11 T G 11: 87,098,707 K279N possibly damaging Het
Sugp1 T C 8: 70,056,388 S104P probably benign Het
Tmem239 A G 2: 130,407,157 Y145C possibly damaging Het
Uchl4 T C 9: 64,235,881 F215L possibly damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Usp7 C T 16: 8,695,895 E785K possibly damaging Het
Vmn2r66 G A 7: 85,007,954 A81V probably damaging Het
Other mutations in Olfr298
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Olfr298 APN 7 86489557 utr 5 prime probably benign
IGL01603:Olfr298 APN 7 86488931 missense possibly damaging 0.92
IGL02389:Olfr298 APN 7 86489128 missense probably damaging 0.98
IGL03146:Olfr298 APN 7 86489194 missense probably damaging 1.00
R0680:Olfr298 UTSW 7 86489337 missense probably benign
R0834:Olfr298 UTSW 7 86489490 missense probably benign 0.11
R1132:Olfr298 UTSW 7 86489217 missense probably benign 0.03
R1519:Olfr298 UTSW 7 86489125 missense probably damaging 0.99
R1881:Olfr298 UTSW 7 86489438 missense probably benign 0.01
R2170:Olfr298 UTSW 7 86488570 missense probably benign 0.03
R4524:Olfr298 UTSW 7 86488826 missense probably damaging 1.00
R5184:Olfr298 UTSW 7 86489291 frame shift probably null
R5521:Olfr298 UTSW 7 86488631 missense probably benign 0.08
R7448:Olfr298 UTSW 7 86489209 missense probably damaging 1.00
R7643:Olfr298 UTSW 7 86489568 critical splice acceptor site probably null
R7688:Olfr298 UTSW 7 86488975 missense probably benign 0.01
R8104:Olfr298 UTSW 7 86489023 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGATTAAGTGCTGGAGGC -3'
(R):5'- CTTTGGAGCTTTATACACAGCTGG -3'

Sequencing Primer
(F):5'- CAGCCTGTCTGAAATTGATGGTAC -3'
(R):5'- ATACACAGCTGGCACATTTTCCATG -3'
Posted On2015-07-21