Incidental Mutation 'R4500:Olfr644'
ID331784
Institutional Source Beutler Lab
Gene Symbol Olfr644
Ensembl Gene ENSMUSG00000110012
Gene Nameolfactory receptor 644
SynonymsGA_x6K02T2PBJ9-6803062-6802118, MOR13-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R4500 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104066289-104071869 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104068195 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 279 (S279P)
Ref Sequence ENSEMBL: ENSMUSP00000149600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077417] [ENSMUST00000138055] [ENSMUST00000213184] [ENSMUST00000213991]
Predicted Effect probably damaging
Transcript: ENSMUST00000077417
AA Change: S279P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076633
Gene: ENSMUSG00000110012
AA Change: S279P

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 2e-122 PFAM
Pfam:7TM_GPCR_Srsx 37 256 5.9e-8 PFAM
Pfam:7tm_1 43 294 1.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213184
AA Change: S279P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213991
AA Change: S279P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T A 16: 88,759,541 C214* probably null Het
4931409K22Rik T C 5: 24,548,277 D459G possibly damaging Het
Ap3s1 T C 18: 46,790,000 V186A possibly damaging Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dpep2 T C 8: 105,985,482 E282G probably benign Het
Fam83d A G 2: 158,785,267 E292G probably benign Het
Gm4981 C T 10: 58,235,706 A229T possibly damaging Het
Hook1 T C 4: 95,993,200 probably null Het
Klhl18 C T 9: 110,429,966 G445S probably damaging Het
Olfr298 A T 7: 86,488,919 C211S probably benign Het
Pias3 C T 3: 96,701,418 R259W probably damaging Het
Prr11 T G 11: 87,098,707 K279N possibly damaging Het
Sugp1 T C 8: 70,056,388 S104P probably benign Het
Tmem239 A G 2: 130,407,157 Y145C possibly damaging Het
Uchl4 T C 9: 64,235,881 F215L possibly damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Usp7 C T 16: 8,695,895 E785K possibly damaging Het
Vmn2r66 G A 7: 85,007,954 A81V probably damaging Het
Other mutations in Olfr644
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01614:Olfr644 APN 7 104068369 missense probably benign 0.00
IGL02937:Olfr644 APN 7 104068849 missense probably damaging 0.99
IGL03188:Olfr644 APN 7 104068738 missense possibly damaging 0.89
FR4737:Olfr644 UTSW 7 104071292 start gained probably benign
R0467:Olfr644 UTSW 7 104068125 missense probably benign 0.07
R1310:Olfr644 UTSW 7 104068598 missense probably benign
R1457:Olfr644 UTSW 7 104068459 missense probably damaging 1.00
R1619:Olfr644 UTSW 7 104068531 missense probably damaging 1.00
R1874:Olfr644 UTSW 7 104068129 missense probably null 1.00
R2428:Olfr644 UTSW 7 104068468 nonsense probably null
R2922:Olfr644 UTSW 7 104068587 missense probably benign 0.09
R2923:Olfr644 UTSW 7 104068587 missense probably benign 0.09
R3929:Olfr644 UTSW 7 104068584 missense probably benign 0.06
R5035:Olfr644 UTSW 7 104068407 missense possibly damaging 0.95
R5303:Olfr644 UTSW 7 104069032 utr 5 prime probably benign
R5464:Olfr644 UTSW 7 104068467 missense possibly damaging 0.72
R5722:Olfr644 UTSW 7 104068723 missense probably damaging 1.00
R5742:Olfr644 UTSW 7 104068205 missense probably damaging 0.97
R6874:Olfr644 UTSW 7 104068189 missense possibly damaging 0.50
R6940:Olfr644 UTSW 7 104068413 missense possibly damaging 0.82
R7848:Olfr644 UTSW 7 104068095 missense probably benign
R8343:Olfr644 UTSW 7 104068176 missense probably damaging 1.00
R8714:Olfr644 UTSW 7 104068276 missense probably damaging 0.97
R8866:Olfr644 UTSW 7 104068912 missense probably damaging 0.99
R8909:Olfr644 UTSW 7 104068825
Predicted Primers PCR Primer
(F):5'- ATCACAGTGCTAAGGTCAAAGATC -3'
(R):5'- ATACTTCGCTCAGTGCTTGC -3'

Sequencing Primer
(F):5'- CTTCAAAACACAAGTTAGTGGAGTC -3'
(R):5'- CTATTGCCTCCCGGGAAGAAAG -3'
Posted On2015-07-21