Incidental Mutation 'R4500:Uchl4'
ID331787
Institutional Source Beutler Lab
Gene Symbol Uchl4
Ensembl Gene ENSMUSG00000035337
Gene Nameubiquitin carboxyl-terminal esterase L4
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4500 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location64235201-64236362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64235881 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 215 (F215L)
Ref Sequence ENSEMBL: ENSMUSP00000045208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005066] [ENSMUST00000039011]
Predicted Effect probably benign
Transcript: ENSMUST00000005066
SMART Domains Protein: ENSMUSP00000005066
Gene: ENSMUSG00000004936

DomainStartEndE-ValueType
low complexity region 30 51 N/A INTRINSIC
S_TKc 68 361 4.44e-80 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000039011
AA Change: F215L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045208
Gene: ENSMUSG00000035337
AA Change: F215L

DomainStartEndE-ValueType
Pfam:Peptidase_C12 6 217 2.2e-65 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T A 16: 88,759,541 C214* probably null Het
4931409K22Rik T C 5: 24,548,277 D459G possibly damaging Het
Ap3s1 T C 18: 46,790,000 V186A possibly damaging Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dpep2 T C 8: 105,985,482 E282G probably benign Het
Fam83d A G 2: 158,785,267 E292G probably benign Het
Gm4981 C T 10: 58,235,706 A229T possibly damaging Het
Hook1 T C 4: 95,993,200 probably null Het
Klhl18 C T 9: 110,429,966 G445S probably damaging Het
Olfr298 A T 7: 86,488,919 C211S probably benign Het
Olfr644 A G 7: 104,068,195 S279P probably damaging Het
Pias3 C T 3: 96,701,418 R259W probably damaging Het
Prr11 T G 11: 87,098,707 K279N possibly damaging Het
Sugp1 T C 8: 70,056,388 S104P probably benign Het
Tmem239 A G 2: 130,407,157 Y145C possibly damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Usp7 C T 16: 8,695,895 E785K possibly damaging Het
Vmn2r66 G A 7: 85,007,954 A81V probably damaging Het
Other mutations in Uchl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Uchl4 APN 9 64235716 missense possibly damaging 0.82
IGL01710:Uchl4 APN 9 64235506 missense probably benign 0.20
IGL02030:Uchl4 APN 9 64235629 missense probably benign
IGL02739:Uchl4 APN 9 64235537 missense probably damaging 1.00
R0026:Uchl4 UTSW 9 64235371 splice site probably null
R0026:Uchl4 UTSW 9 64235371 splice site probably null
R1572:Uchl4 UTSW 9 64235731 missense probably benign
R1801:Uchl4 UTSW 9 64235475 missense probably benign
R2113:Uchl4 UTSW 9 64235536 missense probably damaging 1.00
R4042:Uchl4 UTSW 9 64235557 missense probably benign 0.00
R4625:Uchl4 UTSW 9 64235798 missense probably damaging 1.00
R5176:Uchl4 UTSW 9 64235740 nonsense probably null
R5364:Uchl4 UTSW 9 64235539 missense possibly damaging 0.88
R6581:Uchl4 UTSW 9 64235793 missense possibly damaging 0.93
R7134:Uchl4 UTSW 9 64235339 missense probably damaging 1.00
R7451:Uchl4 UTSW 9 64235731 missense probably benign
R8268:Uchl4 UTSW 9 64235509 missense probably damaging 1.00
R8804:Uchl4 UTSW 9 64235324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAAGGTCAGACTGAGGCAC -3'
(R):5'- TTCAGGAAAGACCGGGCTTC -3'

Sequencing Primer
(F):5'- TCAGACTGAGGCACCAAGTATAG -3'
(R):5'- TCTAGAACTTGGAGAGCCACCTG -3'
Posted On2015-07-21