Incidental Mutation 'R4501:Ncf2'
ID331797
Institutional Source Beutler Lab
Gene Symbol Ncf2
Ensembl Gene ENSMUSG00000026480
Gene Nameneutrophil cytosolic factor 2
SynonymsNOXA2, p67phox, Ncf-2, NADPH oxidase subunit (67kDa)
MMRRC Submission 041753-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R4501 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location152800194-152836991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 152835033 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 432 (Q432E)
Ref Sequence ENSEMBL: ENSMUSP00000140404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027754] [ENSMUST00000043560] [ENSMUST00000073441] [ENSMUST00000111836] [ENSMUST00000186568]
Predicted Effect probably benign
Transcript: ENSMUST00000027754
AA Change: Q432E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000027754
Gene: ENSMUSG00000026480
AA Change: Q432E

DomainStartEndE-ValueType
TPR 37 70 1.42e0 SMART
TPR 71 104 3.58e-6 SMART
TPR 121 154 1.05e1 SMART
SH3 243 298 1.02e-13 SMART
low complexity region 312 326 N/A INTRINSIC
PB1 350 428 2.6e-10 SMART
SH3 459 514 8.36e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043560
SMART Domains Protein: ENSMUSP00000041241
Gene: ENSMUSG00000042772

DomainStartEndE-ValueType
Pfam:EST1 63 177 3.4e-30 PFAM
Pfam:EST1_DNA_bind 179 438 3.3e-64 PFAM
low complexity region 457 465 N/A INTRINSIC
low complexity region 615 633 N/A INTRINSIC
low complexity region 682 710 N/A INTRINSIC
low complexity region 711 729 N/A INTRINSIC
low complexity region 874 898 N/A INTRINSIC
low complexity region 906 922 N/A INTRINSIC
low complexity region 931 947 N/A INTRINSIC
low complexity region 1008 1034 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073441
SMART Domains Protein: ENSMUSP00000073144
Gene: ENSMUSG00000042772

DomainStartEndE-ValueType
Pfam:EST1 52 172 2.3e-26 PFAM
Pfam:EST1_DNA_bind 171 430 3.6e-66 PFAM
low complexity region 449 457 N/A INTRINSIC
low complexity region 653 671 N/A INTRINSIC
low complexity region 720 748 N/A INTRINSIC
low complexity region 749 767 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
low complexity region 996 1022 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111836
SMART Domains Protein: ENSMUSP00000107467
Gene: ENSMUSG00000042772

DomainStartEndE-ValueType
Pfam:EST1 52 172 2.3e-26 PFAM
Pfam:EST1_DNA_bind 171 430 3.7e-66 PFAM
low complexity region 449 457 N/A INTRINSIC
low complexity region 607 625 N/A INTRINSIC
low complexity region 674 702 N/A INTRINSIC
low complexity region 703 721 N/A INTRINSIC
low complexity region 866 890 N/A INTRINSIC
low complexity region 898 914 N/A INTRINSIC
low complexity region 923 939 N/A INTRINSIC
low complexity region 1000 1026 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186568
AA Change: Q432E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140404
Gene: ENSMUSG00000026480
AA Change: Q432E

DomainStartEndE-ValueType
TPR 37 70 1.42e0 SMART
TPR 71 104 3.58e-6 SMART
TPR 121 154 1.05e1 SMART
SH3 243 298 1.02e-13 SMART
low complexity region 312 326 N/A INTRINSIC
PB1 350 428 2.6e-10 SMART
SH3 459 514 8.36e-19 SMART
Meta Mutation Damage Score 0.0580 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes neutrophil cytosolic factor 2, the 67-kilodalton cytosolic subunit of the multi-protein NADPH oxidase complex found in neutrophils. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in this gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A G 14: 54,686,587 V65A probably damaging Het
Ankrd28 A G 14: 31,706,796 L956S probably damaging Het
Atp2a1 G A 7: 126,453,383 T388I probably benign Het
AU018091 A G 7: 3,159,079 V389A probably benign Het
Cdh2 A G 18: 16,629,585 V434A possibly damaging Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dnah2 T A 11: 69,477,659 M1717L probably benign Het
Dusp6 T A 10: 99,264,595 L151Q probably benign Het
Hc A T 2: 34,997,476 probably null Het
Hmcn1 A T 1: 150,633,666 S3644T probably damaging Het
Kcnt2 T C 1: 140,552,980 I761T probably damaging Het
Mmd2 A G 5: 142,575,210 V90A probably benign Het
Nxn T C 11: 76,274,612 E172G probably damaging Het
P2ry12 A G 3: 59,217,657 I199T probably damaging Het
Phldb3 A G 7: 24,612,561 E100G probably benign Het
Pidd1 A G 7: 141,441,443 probably benign Het
Pldi G T 10: 60,928,409 noncoding transcript Het
Plk5 T C 10: 80,359,471 C208R probably benign Het
Ptpn12 G T 5: 21,019,280 A105E probably damaging Het
Pusl1 T C 4: 155,889,542 T252A probably benign Het
Rpl13a T C 7: 45,126,140 H95R probably benign Het
Sh3d21 GAATCTCCTGGGAAAATC GAATC 4: 126,162,859 probably null Het
Slc30a4 A G 2: 122,685,216 I370T probably benign Het
Taf1c A G 8: 119,599,429 F565L probably damaging Het
Tdrd9 A G 12: 112,042,809 K1050E probably benign Het
Tnrc6c T A 11: 117,722,498 L494Q probably damaging Het
Ttn T A 2: 76,794,647 I13450L possibly damaging Het
Usp34 C A 11: 23,401,529 P1439Q probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn1r80 A G 7: 12,193,391 N143D probably benign Het
Zbtb44 G A 9: 31,054,166 V291I probably damaging Het
Other mutations in Ncf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Ncf2 APN 1 152808174 missense possibly damaging 0.49
IGL00952:Ncf2 APN 1 152836106 missense probably benign 0.19
IGL01504:Ncf2 APN 1 152833329 missense probably benign 0.00
IGL01693:Ncf2 APN 1 152824323 missense probably benign 0.00
IGL02005:Ncf2 APN 1 152817052 missense possibly damaging 0.73
IGL02041:Ncf2 APN 1 152836120 utr 3 prime probably benign
IGL02327:Ncf2 APN 1 152816993 missense possibly damaging 0.49
IGL02366:Ncf2 APN 1 152835073 missense probably benign
IGL02627:Ncf2 APN 1 152811008 splice site probably benign
R0560:Ncf2 UTSW 1 152821522 missense probably damaging 1.00
R1136:Ncf2 UTSW 1 152830372 missense probably damaging 1.00
R1640:Ncf2 UTSW 1 152808033 start codon destroyed probably null 1.00
R1673:Ncf2 UTSW 1 152830479 missense probably benign 0.13
R1836:Ncf2 UTSW 1 152808071 missense probably damaging 1.00
R1873:Ncf2 UTSW 1 152825910 missense probably benign 0.00
R1940:Ncf2 UTSW 1 152834064 splice site probably benign
R1967:Ncf2 UTSW 1 152830372 missense probably damaging 1.00
R3405:Ncf2 UTSW 1 152825947 unclassified probably benign
R3406:Ncf2 UTSW 1 152825947 unclassified probably benign
R4503:Ncf2 UTSW 1 152833778 missense probably benign 0.20
R4563:Ncf2 UTSW 1 152808225 intron probably benign
R5841:Ncf2 UTSW 1 152821518 splice site silent
R6336:Ncf2 UTSW 1 152834070 missense probably damaging 1.00
R6385:Ncf2 UTSW 1 152830422 missense probably benign 0.00
R6522:Ncf2 UTSW 1 152827463 critical splice donor site probably null
R6811:Ncf2 UTSW 1 152836040 missense probably benign 0.00
R7048:Ncf2 UTSW 1 152808170 missense probably benign
X0066:Ncf2 UTSW 1 152810979 start codon destroyed probably null 0.27
Z1177:Ncf2 UTSW 1 152825942 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCAATTTAAAGCTACATAGGGC -3'
(R):5'- CTGATACATGCATGCCTCTGG -3'

Sequencing Primer
(F):5'- GCTACATAGGGCTCTGTACAC -3'
(R):5'- GTAGCACTTACCATGTGACAGTAC -3'
Posted On2015-07-21