Incidental Mutation 'R4501:Slc30a4'
ID331800
Institutional Source Beutler Lab
Gene Symbol Slc30a4
Ensembl Gene ENSMUSG00000005802
Gene Namesolute carrier family 30 (zinc transporter), member 4
SynonymsZnt4
MMRRC Submission 041753-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4501 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location122681233-122702663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122685216 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 370 (I370T)
Ref Sequence ENSEMBL: ENSMUSP00000097056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005952] [ENSMUST00000099457]
Predicted Effect probably benign
Transcript: ENSMUST00000005952
AA Change: I419T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005952
Gene: ENSMUSG00000005802
AA Change: I419T

DomainStartEndE-ValueType
low complexity region 67 83 N/A INTRINSIC
Pfam:Cation_efflux 114 333 1.3e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099457
AA Change: I370T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097056
Gene: ENSMUSG00000005802
AA Change: I370T

DomainStartEndE-ValueType
low complexity region 67 83 N/A INTRINSIC
Pfam:Cation_efflux 124 368 4.6e-46 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is the second most abundant trace metal in the human body. It is an essential element, serving both a structural role, as in the formation of zinc fingers in DNA-binding proteins, and a catalytic role in metalloenzymes, such as pancreatic carboxypeptidases (e.g., MIM 114852), alkaline phosphatases (e.g., MIM 171760), various dehydrogenases, and superoxide dismutases (e.g., MIM 147450). SLC30A4, or ZNT4, belongs to the ZNT family of zinc transporters. ZNTs are involved in transporting zinc out of the cytoplasm and have similar structures, consisting of 6 transmembrane domains and a histidine-rich cytoplasmic loop (Huang and Gitschier, 1997 [PubMed 9354792]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant dams produce zinc-deficient milk that is lethal to all nursing pups. Pleiotropic defects observed in mutant males and females include otolith degeneration, impaired motor coordination, alopecia, and dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A G 14: 54,686,587 V65A probably damaging Het
Ankrd28 A G 14: 31,706,796 L956S probably damaging Het
Atp2a1 G A 7: 126,453,383 T388I probably benign Het
AU018091 A G 7: 3,159,079 V389A probably benign Het
Cdh2 A G 18: 16,629,585 V434A possibly damaging Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dnah2 T A 11: 69,477,659 M1717L probably benign Het
Dusp6 T A 10: 99,264,595 L151Q probably benign Het
Hc A T 2: 34,997,476 probably null Het
Hmcn1 A T 1: 150,633,666 S3644T probably damaging Het
Kcnt2 T C 1: 140,552,980 I761T probably damaging Het
Mmd2 A G 5: 142,575,210 V90A probably benign Het
Ncf2 C G 1: 152,835,033 Q432E probably benign Het
Nxn T C 11: 76,274,612 E172G probably damaging Het
P2ry12 A G 3: 59,217,657 I199T probably damaging Het
Phldb3 A G 7: 24,612,561 E100G probably benign Het
Pidd1 A G 7: 141,441,443 probably benign Het
Pldi G T 10: 60,928,409 noncoding transcript Het
Plk5 T C 10: 80,359,471 C208R probably benign Het
Ptpn12 G T 5: 21,019,280 A105E probably damaging Het
Pusl1 T C 4: 155,889,542 T252A probably benign Het
Rpl13a T C 7: 45,126,140 H95R probably benign Het
Sh3d21 GAATCTCCTGGGAAAATC GAATC 4: 126,162,859 probably null Het
Taf1c A G 8: 119,599,429 F565L probably damaging Het
Tdrd9 A G 12: 112,042,809 K1050E probably benign Het
Tnrc6c T A 11: 117,722,498 L494Q probably damaging Het
Ttn T A 2: 76,794,647 I13450L possibly damaging Het
Usp34 C A 11: 23,401,529 P1439Q probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn1r80 A G 7: 12,193,391 N143D probably benign Het
Zbtb44 G A 9: 31,054,166 V291I probably damaging Het
Other mutations in Slc30a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Slc30a4 APN 2 122702388 missense possibly damaging 0.87
IGL01583:Slc30a4 APN 2 122685217 missense probably benign
IGL01823:Slc30a4 APN 2 122702092 missense probably damaging 1.00
IGL02086:Slc30a4 APN 2 122702027 splice site probably benign
F5770:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
R0060:Slc30a4 UTSW 2 122685184 missense probably benign
R0060:Slc30a4 UTSW 2 122685184 missense probably benign
R0373:Slc30a4 UTSW 2 122689399 missense probably damaging 0.99
R0591:Slc30a4 UTSW 2 122685240 missense probably damaging 1.00
R1514:Slc30a4 UTSW 2 122689414 missense probably damaging 1.00
R1552:Slc30a4 UTSW 2 122686016 missense probably benign 0.05
R3847:Slc30a4 UTSW 2 122702272 missense probably damaging 1.00
R4195:Slc30a4 UTSW 2 122685270 missense probably damaging 1.00
R5558:Slc30a4 UTSW 2 122686983 missense probably damaging 1.00
R6379:Slc30a4 UTSW 2 122689549 missense probably damaging 1.00
R6393:Slc30a4 UTSW 2 122686046 missense probably damaging 1.00
R7394:Slc30a4 UTSW 2 122685304 missense possibly damaging 0.93
V7580:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
V7581:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
V7582:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
V7583:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGAGCGGAGTCTGTCTTG -3'
(R):5'- GGGCTTAGAAACTGCCTTCTG -3'

Sequencing Primer
(F):5'- GGGGAGACTGGTGCTTGAC -3'
(R):5'- TTCTGCAGTAGAAGGGCTTAAG -3'
Posted On2015-07-21