Incidental Mutation 'R4501:Vmn1r80'
ID331809
Institutional Source Beutler Lab
Gene Symbol Vmn1r80
Ensembl Gene ENSMUSG00000115744
Gene Namevomeronasal 1 receptor 80
SynonymsV1rg3
MMRRC Submission 041753-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R4501 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12189286-12203313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12193391 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 143 (N143D)
Ref Sequence ENSEMBL: ENSMUSP00000153967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075053] [ENSMUST00000227205] [ENSMUST00000227471] [ENSMUST00000227755] [ENSMUST00000228028] [ENSMUST00000228578]
Predicted Effect probably benign
Transcript: ENSMUST00000075053
AA Change: N143D

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074564
Gene: ENSMUSG00000115744
AA Change: N143D

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 5.4e-11 PFAM
Pfam:7tm_1 23 290 5.3e-7 PFAM
Pfam:V1R 31 298 3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227205
AA Change: N143D

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227240
Predicted Effect probably benign
Transcript: ENSMUST00000227471
AA Change: N143D

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000227755
AA Change: N143D

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000228028
AA Change: N143D

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228563
Predicted Effect probably benign
Transcript: ENSMUST00000228578
AA Change: N143D

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A G 14: 54,686,587 V65A probably damaging Het
Ankrd28 A G 14: 31,706,796 L956S probably damaging Het
Atp2a1 G A 7: 126,453,383 T388I probably benign Het
AU018091 A G 7: 3,159,079 V389A probably benign Het
Cdh2 A G 18: 16,629,585 V434A possibly damaging Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dnah2 T A 11: 69,477,659 M1717L probably benign Het
Dusp6 T A 10: 99,264,595 L151Q probably benign Het
Hc A T 2: 34,997,476 probably null Het
Hmcn1 A T 1: 150,633,666 S3644T probably damaging Het
Kcnt2 T C 1: 140,552,980 I761T probably damaging Het
Mmd2 A G 5: 142,575,210 V90A probably benign Het
Ncf2 C G 1: 152,835,033 Q432E probably benign Het
Nxn T C 11: 76,274,612 E172G probably damaging Het
P2ry12 A G 3: 59,217,657 I199T probably damaging Het
Phldb3 A G 7: 24,612,561 E100G probably benign Het
Pidd1 A G 7: 141,441,443 probably benign Het
Pldi G T 10: 60,928,409 noncoding transcript Het
Plk5 T C 10: 80,359,471 C208R probably benign Het
Ptpn12 G T 5: 21,019,280 A105E probably damaging Het
Pusl1 T C 4: 155,889,542 T252A probably benign Het
Rpl13a T C 7: 45,126,140 H95R probably benign Het
Sh3d21 GAATCTCCTGGGAAAATC GAATC 4: 126,162,859 probably null Het
Slc30a4 A G 2: 122,685,216 I370T probably benign Het
Taf1c A G 8: 119,599,429 F565L probably damaging Het
Tdrd9 A G 12: 112,042,809 K1050E probably benign Het
Tnrc6c T A 11: 117,722,498 L494Q probably damaging Het
Ttn T A 2: 76,794,647 I13450L possibly damaging Het
Usp34 C A 11: 23,401,529 P1439Q probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Zbtb44 G A 9: 31,054,166 V291I probably damaging Het
Other mutations in Vmn1r80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Vmn1r80 APN 7 12193380 missense possibly damaging 0.69
IGL01652:Vmn1r80 APN 7 12193136 missense probably benign 0.19
IGL02102:Vmn1r80 APN 7 12193691 missense probably damaging 1.00
IGL02165:Vmn1r80 APN 7 12193452 missense probably benign 0.31
IGL02328:Vmn1r80 APN 7 12193478 missense probably benign 0.12
IGL02336:Vmn1r80 APN 7 12193254 missense probably benign 0.23
IGL02606:Vmn1r80 APN 7 12193032 missense probably damaging 1.00
R0310:Vmn1r80 UTSW 7 12193848 missense probably benign 0.00
R0399:Vmn1r80 UTSW 7 12193317 missense possibly damaging 0.88
R1983:Vmn1r80 UTSW 7 12193661 missense probably benign 0.01
R2079:Vmn1r80 UTSW 7 12193194 missense probably damaging 1.00
R4278:Vmn1r80 UTSW 7 12193527 missense probably benign 0.00
R5894:Vmn1r80 UTSW 7 12193727 missense probably damaging 0.99
R5991:Vmn1r80 UTSW 7 12193496 missense probably benign 0.09
R6552:Vmn1r80 UTSW 7 12193757 missense probably damaging 0.98
R7560:Vmn1r80 UTSW 7 12193823 missense probably damaging 0.98
R7659:Vmn1r80 UTSW 7 12193050 missense probably damaging 1.00
R8313:Vmn1r80 UTSW 7 12193067 missense probably benign 0.00
Z1189:Vmn1r80 UTSW 7 12193433 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACAGACACTGTCAGATTACG -3'
(R):5'- ATAGGCCATGAGACCCAGAC -3'

Sequencing Primer
(F):5'- GACACTGTCAGATTACGGATTAAAAG -3'
(R):5'- TGAGACCCAGACACAGTCCATC -3'
Posted On2015-07-21