Incidental Mutation 'R4501:Taf1c'
ID331815
Institutional Source Beutler Lab
Gene Symbol Taf1c
Ensembl Gene ENSMUSG00000031832
Gene NameTATA-box binding protein associated factor, RNA polymerase I, C
SynonymsmTAFI95
MMRRC Submission 041753-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R4501 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location119597871-119605222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119599429 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 565 (F565L)
Ref Sequence ENSEMBL: ENSMUSP00000090789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093099] [ENSMUST00000093100] [ENSMUST00000147964]
Predicted Effect probably damaging
Transcript: ENSMUST00000093099
AA Change: F565L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090789
Gene: ENSMUSG00000031832
AA Change: F565L

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
SCOP:d1k32a3 253 389 2e-3 SMART
Blast:WD40 301 340 2e-15 BLAST
low complexity region 457 472 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 520 535 N/A INTRINSIC
low complexity region 724 732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093100
SMART Domains Protein: ENSMUSP00000090790
Gene: ENSMUSG00000031831

DomainStartEndE-ValueType
Pfam:LRR_9 115 298 5.7e-10 PFAM
low complexity region 322 332 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144379
Predicted Effect probably benign
Transcript: ENSMUST00000147964
SMART Domains Protein: ENSMUSP00000118480
Gene: ENSMUSG00000031832

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212929
Meta Mutation Damage Score 0.8155 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes the largest SL1-specific TAF. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A G 14: 54,686,587 V65A probably damaging Het
Ankrd28 A G 14: 31,706,796 L956S probably damaging Het
Atp2a1 G A 7: 126,453,383 T388I probably benign Het
AU018091 A G 7: 3,159,079 V389A probably benign Het
Cdh2 A G 18: 16,629,585 V434A possibly damaging Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dnah2 T A 11: 69,477,659 M1717L probably benign Het
Dusp6 T A 10: 99,264,595 L151Q probably benign Het
Hc A T 2: 34,997,476 probably null Het
Hmcn1 A T 1: 150,633,666 S3644T probably damaging Het
Kcnt2 T C 1: 140,552,980 I761T probably damaging Het
Mmd2 A G 5: 142,575,210 V90A probably benign Het
Ncf2 C G 1: 152,835,033 Q432E probably benign Het
Nxn T C 11: 76,274,612 E172G probably damaging Het
P2ry12 A G 3: 59,217,657 I199T probably damaging Het
Phldb3 A G 7: 24,612,561 E100G probably benign Het
Pidd1 A G 7: 141,441,443 probably benign Het
Pldi G T 10: 60,928,409 noncoding transcript Het
Plk5 T C 10: 80,359,471 C208R probably benign Het
Ptpn12 G T 5: 21,019,280 A105E probably damaging Het
Pusl1 T C 4: 155,889,542 T252A probably benign Het
Rpl13a T C 7: 45,126,140 H95R probably benign Het
Sh3d21 GAATCTCCTGGGAAAATC GAATC 4: 126,162,859 probably null Het
Slc30a4 A G 2: 122,685,216 I370T probably benign Het
Tdrd9 A G 12: 112,042,809 K1050E probably benign Het
Tnrc6c T A 11: 117,722,498 L494Q probably damaging Het
Ttn T A 2: 76,794,647 I13450L possibly damaging Het
Usp34 C A 11: 23,401,529 P1439Q probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn1r80 A G 7: 12,193,391 N143D probably benign Het
Zbtb44 G A 9: 31,054,166 V291I probably damaging Het
Other mutations in Taf1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Taf1c APN 8 119601328 missense possibly damaging 0.80
IGL01098:Taf1c APN 8 119602841 missense probably damaging 0.98
IGL01287:Taf1c APN 8 119601192 missense probably benign 0.01
IGL02339:Taf1c APN 8 119604280 missense probably damaging 1.00
IGL02642:Taf1c APN 8 119599057 missense probably benign
IGL02954:Taf1c APN 8 119600486 missense probably damaging 1.00
R0026:Taf1c UTSW 8 119604236 splice site probably null
R0031:Taf1c UTSW 8 119599090 missense probably benign 0.00
R0087:Taf1c UTSW 8 119600987 missense probably damaging 1.00
R0197:Taf1c UTSW 8 119599983 missense probably damaging 0.98
R0701:Taf1c UTSW 8 119599983 missense probably damaging 0.98
R0883:Taf1c UTSW 8 119599983 missense probably damaging 0.98
R2200:Taf1c UTSW 8 119598678 missense probably benign
R3726:Taf1c UTSW 8 119603070 missense probably damaging 1.00
R3765:Taf1c UTSW 8 119600485 nonsense probably null
R3916:Taf1c UTSW 8 119600505 missense probably damaging 1.00
R4368:Taf1c UTSW 8 119599316 missense possibly damaging 0.60
R4470:Taf1c UTSW 8 119599622 missense probably benign
R4661:Taf1c UTSW 8 119598850 missense probably damaging 0.99
R4741:Taf1c UTSW 8 119603395 unclassified probably benign
R4938:Taf1c UTSW 8 119598798 missense probably benign 0.26
R5481:Taf1c UTSW 8 119599240 missense probably damaging 1.00
R6335:Taf1c UTSW 8 119601779 missense probably damaging 1.00
R6517:Taf1c UTSW 8 119604247 missense possibly damaging 0.59
R7083:Taf1c UTSW 8 119600668 missense probably damaging 1.00
R7351:Taf1c UTSW 8 119599000 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTCCATGTGGCCCAGAAAAC -3'
(R):5'- CTGGAACCTAAGAAGCAGCAGC -3'

Sequencing Primer
(F):5'- GCCCAGAAAACGGCGATG -3'
(R):5'- TGCTGCAGGAACGTCTG -3'
Posted On2015-07-21