Incidental Mutation 'R4501:Plk5'
ID331819
Institutional Source Beutler Lab
Gene Symbol Plk5
Ensembl Gene ENSMUSG00000035486
Gene Namepolo like kinase 5
Synonyms
MMRRC Submission 041753-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4501 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80356459-80365489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80359471 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 208 (C208R)
Ref Sequence ENSEMBL: ENSMUSP00000044400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039836] [ENSMUST00000105351]
Predicted Effect probably benign
Transcript: ENSMUST00000039836
AA Change: C208R

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000044400
Gene: ENSMUSG00000035486
AA Change: C208R

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
S_TKc 27 283 2.41e-90 SMART
Pfam:POLO_box 425 486 4.9e-18 PFAM
low complexity region 583 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105351
AA Change: C204R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100988
Gene: ENSMUSG00000035486
AA Change: C204R

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
S_TKc 27 279 2.56e-94 SMART
Pfam:POLO_box 420 483 1.6e-17 PFAM
low complexity region 579 592 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152544
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A G 14: 54,686,587 V65A probably damaging Het
Ankrd28 A G 14: 31,706,796 L956S probably damaging Het
Atp2a1 G A 7: 126,453,383 T388I probably benign Het
AU018091 A G 7: 3,159,079 V389A probably benign Het
Cdh2 A G 18: 16,629,585 V434A possibly damaging Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dnah2 T A 11: 69,477,659 M1717L probably benign Het
Dusp6 T A 10: 99,264,595 L151Q probably benign Het
Hc A T 2: 34,997,476 probably null Het
Hmcn1 A T 1: 150,633,666 S3644T probably damaging Het
Kcnt2 T C 1: 140,552,980 I761T probably damaging Het
Mmd2 A G 5: 142,575,210 V90A probably benign Het
Ncf2 C G 1: 152,835,033 Q432E probably benign Het
Nxn T C 11: 76,274,612 E172G probably damaging Het
P2ry12 A G 3: 59,217,657 I199T probably damaging Het
Phldb3 A G 7: 24,612,561 E100G probably benign Het
Pidd1 A G 7: 141,441,443 probably benign Het
Pldi G T 10: 60,928,409 noncoding transcript Het
Ptpn12 G T 5: 21,019,280 A105E probably damaging Het
Pusl1 T C 4: 155,889,542 T252A probably benign Het
Rpl13a T C 7: 45,126,140 H95R probably benign Het
Sh3d21 GAATCTCCTGGGAAAATC GAATC 4: 126,162,859 probably null Het
Slc30a4 A G 2: 122,685,216 I370T probably benign Het
Taf1c A G 8: 119,599,429 F565L probably damaging Het
Tdrd9 A G 12: 112,042,809 K1050E probably benign Het
Tnrc6c T A 11: 117,722,498 L494Q probably damaging Het
Ttn T A 2: 76,794,647 I13450L possibly damaging Het
Usp34 C A 11: 23,401,529 P1439Q probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn1r80 A G 7: 12,193,391 N143D probably benign Het
Zbtb44 G A 9: 31,054,166 V291I probably damaging Het
Other mutations in Plk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Plk5 APN 10 80363167 critical splice donor site probably null
IGL02605:Plk5 APN 10 80363062 missense probably damaging 0.99
R0083:Plk5 UTSW 10 80356662 missense possibly damaging 0.91
R0590:Plk5 UTSW 10 80360223 missense probably damaging 1.00
R0783:Plk5 UTSW 10 80361130 missense probably benign
R1815:Plk5 UTSW 10 80364021 missense probably benign 0.03
R1866:Plk5 UTSW 10 80360569 splice site probably null
R1991:Plk5 UTSW 10 80363102 missense possibly damaging 0.53
R4580:Plk5 UTSW 10 80360467 missense possibly damaging 0.95
R4731:Plk5 UTSW 10 80358797 missense probably damaging 1.00
R4801:Plk5 UTSW 10 80359304 missense possibly damaging 0.87
R4802:Plk5 UTSW 10 80359304 missense possibly damaging 0.87
R5084:Plk5 UTSW 10 80358889 missense possibly damaging 0.75
R5346:Plk5 UTSW 10 80363108 missense probably damaging 1.00
R5702:Plk5 UTSW 10 80360567 critical splice donor site probably null
R6417:Plk5 UTSW 10 80364072 missense probably benign 0.07
R6548:Plk5 UTSW 10 80363045 missense probably damaging 1.00
R6695:Plk5 UTSW 10 80360201 missense probably benign 0.22
X0019:Plk5 UTSW 10 80364301 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCCTTAACAAGAACATGGAGG -3'
(R):5'- GATCTCCGTGTGTGCACATC -3'

Sequencing Primer
(F):5'- TCCTTAACAAGAACATGGAGGTTAAG -3'
(R):5'- CGTGTGTGCACATCTGTCCATG -3'
Posted On2015-07-21