Incidental Mutation 'R4501:Dusp6'
ID 331820
Institutional Source Beutler Lab
Gene Symbol Dusp6
Ensembl Gene ENSMUSG00000019960
Gene Name dual specificity phosphatase 6
Synonyms 1300019I03Rik, MKP-3, PYST1, MKP3
MMRRC Submission 041753-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.423) question?
Stock # R4501 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 99099093-99103351 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 99100457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 151 (L151Q)
Ref Sequence ENSEMBL: ENSMUSP00000020118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020118] [ENSMUST00000220291]
AlphaFold Q9DBB1
Predicted Effect probably benign
Transcript: ENSMUST00000020118
AA Change: L151Q

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020118
Gene: ENSMUSG00000019960
AA Change: L151Q

DomainStartEndE-ValueType
RHOD 20 145 3.06e-13 SMART
low complexity region 151 187 N/A INTRINSIC
DSPc 206 346 5.51e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220218
Predicted Effect probably benign
Transcript: ENSMUST00000220291
Meta Mutation Damage Score 0.1571 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Mutations in this gene have been associated with congenital hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display partial penetrance of postnatal lethality, reduced body weight, and abnormal growth plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A G 14: 54,924,044 (GRCm39) V65A probably damaging Het
Ankrd28 A G 14: 31,428,753 (GRCm39) L956S probably damaging Het
Atp2a1 G A 7: 126,052,555 (GRCm39) T388I probably benign Het
AU018091 A G 7: 3,208,919 (GRCm39) V389A probably benign Het
Cdh2 A G 18: 16,762,642 (GRCm39) V434A possibly damaging Het
Dennd4a G A 9: 64,817,405 (GRCm39) D1680N possibly damaging Het
Dnah2 T A 11: 69,368,485 (GRCm39) M1717L probably benign Het
Hc A T 2: 34,887,488 (GRCm39) probably null Het
Hmcn1 A T 1: 150,509,417 (GRCm39) S3644T probably damaging Het
Kcnt2 T C 1: 140,480,718 (GRCm39) I761T probably damaging Het
Mmd2 A G 5: 142,560,965 (GRCm39) V90A probably benign Het
Ncf2 C G 1: 152,710,784 (GRCm39) Q432E probably benign Het
Nxn T C 11: 76,165,438 (GRCm39) E172G probably damaging Het
P2ry12 A G 3: 59,125,078 (GRCm39) I199T probably damaging Het
Phldb3 A G 7: 24,311,986 (GRCm39) E100G probably benign Het
Pidd1 A G 7: 141,021,356 (GRCm39) probably benign Het
Pldi G T 10: 60,764,188 (GRCm39) noncoding transcript Het
Plk5 T C 10: 80,195,305 (GRCm39) C208R probably benign Het
Ptpn12 G T 5: 21,224,278 (GRCm39) A105E probably damaging Het
Pusl1 T C 4: 155,973,999 (GRCm39) T252A probably benign Het
Rpl13a T C 7: 44,775,564 (GRCm39) H95R probably benign Het
Sh3d21 GAATCTCCTGGGAAAATC GAATC 4: 126,056,652 (GRCm39) probably null Het
Slc30a4 A G 2: 122,527,136 (GRCm39) I370T probably benign Het
Taf1c A G 8: 120,326,168 (GRCm39) F565L probably damaging Het
Tdrd9 A G 12: 112,009,243 (GRCm39) K1050E probably benign Het
Tnrc6c T A 11: 117,613,324 (GRCm39) L494Q probably damaging Het
Ttn T A 2: 76,624,991 (GRCm39) I13450L possibly damaging Het
Usp34 C A 11: 23,351,529 (GRCm39) P1439Q probably damaging Het
Usp5 C G 6: 124,799,593 (GRCm39) K318N possibly damaging Het
Vmn1r80 A G 7: 11,927,318 (GRCm39) N143D probably benign Het
Zbtb44 G A 9: 30,965,462 (GRCm39) V291I probably damaging Het
Other mutations in Dusp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02272:Dusp6 APN 10 99,101,881 (GRCm39) missense probably damaging 1.00
IGL02687:Dusp6 APN 10 99,102,044 (GRCm39) missense probably damaging 0.97
IGL02996:Dusp6 APN 10 99,100,628 (GRCm39) missense possibly damaging 0.52
IGL03024:Dusp6 APN 10 99,102,156 (GRCm39) missense probably damaging 0.97
R1134:Dusp6 UTSW 10 99,100,816 (GRCm39) missense probably damaging 0.98
R1695:Dusp6 UTSW 10 99,099,555 (GRCm39) start codon destroyed probably null 0.99
R2078:Dusp6 UTSW 10 99,099,686 (GRCm39) missense probably damaging 1.00
R2899:Dusp6 UTSW 10 99,099,707 (GRCm39) missense probably damaging 1.00
R3162:Dusp6 UTSW 10 99,099,944 (GRCm39) missense probably damaging 1.00
R3162:Dusp6 UTSW 10 99,099,944 (GRCm39) missense probably damaging 1.00
R4413:Dusp6 UTSW 10 99,099,786 (GRCm39) missense probably damaging 1.00
R5175:Dusp6 UTSW 10 99,099,864 (GRCm39) missense possibly damaging 0.91
R5381:Dusp6 UTSW 10 99,102,129 (GRCm39) missense possibly damaging 0.46
R5560:Dusp6 UTSW 10 99,102,103 (GRCm39) missense probably damaging 0.97
R5820:Dusp6 UTSW 10 99,099,864 (GRCm39) missense possibly damaging 0.91
R7359:Dusp6 UTSW 10 99,099,927 (GRCm39) missense probably benign 0.01
R7398:Dusp6 UTSW 10 99,100,740 (GRCm39) missense probably damaging 1.00
R8075:Dusp6 UTSW 10 99,100,810 (GRCm39) missense possibly damaging 0.63
R8491:Dusp6 UTSW 10 99,102,081 (GRCm39) missense possibly damaging 0.66
R8826:Dusp6 UTSW 10 99,099,469 (GRCm39) start gained probably benign
R9084:Dusp6 UTSW 10 99,099,692 (GRCm39) missense probably benign 0.13
R9125:Dusp6 UTSW 10 99,102,074 (GRCm39) nonsense probably null
R9389:Dusp6 UTSW 10 99,099,839 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTAAGCAGCGGGTAGTGTTC -3'
(R):5'- GGAAGGGCAAAATCTCCACC -3'

Sequencing Primer
(F):5'- TTCCTAAAGGTGCGCATTGAAGC -3'
(R):5'- TCTCCACCGGGAAGGAAG -3'
Posted On 2015-07-21