Incidental Mutation 'R4502:Agtr1b'
ID331840
Institutional Source Beutler Lab
Gene Symbol Agtr1b
Ensembl Gene ENSMUSG00000054988
Gene Nameangiotensin II receptor, type 1b
SynonymsAgtr-1b, Angtr-1b, AT1B
MMRRC Submission 041754-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4502 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location20314473-20367177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 20315798 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 215 (Y215D)
Ref Sequence ENSEMBL: ENSMUSP00000128724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068316] [ENSMUST00000163776]
Predicted Effect probably damaging
Transcript: ENSMUST00000068316
AA Change: Y215D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068298
Gene: ENSMUSG00000054988
AA Change: Y215D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 39 310 5.4e-10 PFAM
Pfam:7tm_1 45 302 3e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163776
AA Change: Y215D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128724
Gene: ENSMUSG00000054988
AA Change: Y215D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 39 310 5.4e-10 PFAM
Pfam:7tm_1 45 302 1.1e-65 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations are phenotypically normal, but homozygotes for the Agtr1b/Agtr1a double knockout exhibit reductions in growth, survival, blood pressure, and kidney size not found in either single knockout. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arf5 T C 6: 28,425,776 V123A possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atm A G 9: 53,495,946 V1164A possibly damaging Het
Atp6v0d1 A G 8: 105,565,798 C39R probably damaging Het
Bmp8a T A 4: 123,342,399 S104C probably damaging Het
Cand1 T C 10: 119,216,667 T185A probably benign Het
Ccdc171 A G 4: 83,864,323 E1284G probably damaging Het
Chodl A G 16: 78,931,444 S26G possibly damaging Het
Cic C T 7: 25,288,467 P620S probably damaging Het
Col3a1 T C 1: 45,348,677 probably benign Het
Dirc2 T C 16: 35,719,417 M345V probably benign Het
Dpyd G T 3: 118,797,537 G225C probably damaging Het
Dst G A 1: 34,247,691 V5560M probably damaging Het
Eea1 G A 10: 96,039,565 E1233K probably benign Het
Fryl T C 5: 73,088,397 D1139G probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hc T C 2: 35,006,252 D1173G probably benign Het
Htr2a T A 14: 74,641,988 M19K probably benign Het
Kank4 G A 4: 98,777,098 S653L possibly damaging Het
Kcnt2 G T 1: 140,507,747 C484F probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klhl1 A G 14: 96,517,846 S158P probably benign Het
Ldb2 T C 5: 44,669,407 D62G probably damaging Het
Ldhb T C 6: 142,490,457 K329E possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Olfr1370 A T 13: 21,072,746 I185N probably damaging Het
Olfr178 T C 16: 58,890,176 I15V probably benign Het
Olfr303 T A 7: 86,395,277 T74S possibly damaging Het
Pi4kb T A 3: 94,996,607 H501Q probably benign Het
Ppargc1b T C 18: 61,302,679 K910R probably benign Het
Ppp1r12a G T 10: 108,249,478 R428I probably benign Het
Rbbp8nl G T 2: 180,279,196 T465N possibly damaging Het
Rpl5 T C 5: 107,904,857 F223S possibly damaging Het
Scpep1 T C 11: 88,944,385 K154R probably benign Het
Sil1 T C 18: 35,317,875 Y249C probably benign Het
Slc12a1 T A 2: 125,226,044 L1017Q probably damaging Het
Slc2a9 T C 5: 38,398,811 N264S probably benign Het
Tdrd5 T A 1: 156,300,764 M141L probably benign Het
Tdrd9 T C 12: 111,993,825 C182R probably damaging Het
Thap4 T C 1: 93,750,987 probably null Het
Tmem131 T C 1: 36,825,479 T558A probably benign Het
Tnks1bp1 C T 2: 85,062,647 R973* probably null Het
Ulk3 A G 9: 57,593,229 Y307C probably damaging Het
Usp25 T C 16: 77,115,396 L1001P probably damaging Het
Vmn2r80 A T 10: 79,148,930 T39S probably benign Het
Vps33b G A 7: 80,287,907 A468T possibly damaging Het
Wnt9a T C 11: 59,328,537 S130P probably damaging Het
Zfp236 T C 18: 82,636,954 E730G probably benign Het
Zfp689 C A 7: 127,448,753 V36L probably benign Het
Zfp938 A G 10: 82,226,271 S172P possibly damaging Het
Other mutations in Agtr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01558:Agtr1b APN 3 20316260 missense probably damaging 0.99
IGL02706:Agtr1b APN 3 20315863 missense probably benign 0.01
IGL02958:Agtr1b APN 3 20316094 missense possibly damaging 0.91
IGL03243:Agtr1b APN 3 20315795 missense probably benign 0.13
R0125:Agtr1b UTSW 3 20315540 missense probably benign 0.00
R0565:Agtr1b UTSW 3 20315674 missense probably damaging 0.99
R0661:Agtr1b UTSW 3 20315999 missense possibly damaging 0.83
R1070:Agtr1b UTSW 3 20315748 missense probably benign 0.34
R1469:Agtr1b UTSW 3 20315500 missense probably damaging 1.00
R1469:Agtr1b UTSW 3 20315500 missense probably damaging 1.00
R1713:Agtr1b UTSW 3 20316309 missense probably benign 0.00
R5613:Agtr1b UTSW 3 20316260 missense probably damaging 0.99
R6142:Agtr1b UTSW 3 20316394 missense probably benign 0.06
R6320:Agtr1b UTSW 3 20315779 missense probably benign 0.22
R6667:Agtr1b UTSW 3 20315749 missense possibly damaging 0.91
R6987:Agtr1b UTSW 3 20316421 missense probably benign 0.00
R7407:Agtr1b UTSW 3 20315731 missense possibly damaging 0.79
R7598:Agtr1b UTSW 3 20315913 missense possibly damaging 0.91
X0037:Agtr1b UTSW 3 20316388 missense probably damaging 1.00
X0060:Agtr1b UTSW 3 20316388 missense probably damaging 1.00
X0063:Agtr1b UTSW 3 20316388 missense probably damaging 1.00
X0063:Agtr1b UTSW 3 20315506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTACGTCCGCAATTTCACAG -3'
(R):5'- CACCTGCATCATCATCTGGC -3'

Sequencing Primer
(F):5'- GTCCGCAATTTCACAGTCATGGATG -3'
(R):5'- CATCTGGCTGATGGCTGGC -3'
Posted On2015-07-21