Incidental Mutation 'R4502:Kank4'
ID331844
Institutional Source Beutler Lab
Gene Symbol Kank4
Ensembl Gene ENSMUSG00000035407
Gene NameKN motif and ankyrin repeat domains 4
SynonymsAnkrd38
MMRRC Submission 041754-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R4502 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location98754898-98817537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98777098 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 653 (S653L)
Ref Sequence ENSEMBL: ENSMUSP00000099851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102790]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102790
AA Change: S653L

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099851
Gene: ENSMUSG00000035407
AA Change: S653L

DomainStartEndE-ValueType
Pfam:KN_motif 24 62 5.6e-26 PFAM
low complexity region 280 295 N/A INTRINSIC
low complexity region 300 320 N/A INTRINSIC
coiled coil region 345 409 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 600 624 N/A INTRINSIC
low complexity region 625 655 N/A INTRINSIC
low complexity region 685 709 N/A INTRINSIC
ANK 838 868 7.42e-4 SMART
ANK 877 905 2.08e3 SMART
ANK 910 939 1.11e-2 SMART
ANK 943 973 8.99e-3 SMART
ANK 977 1006 2.43e3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b A C 3: 20,315,798 Y215D probably damaging Het
Arf5 T C 6: 28,425,776 V123A possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atm A G 9: 53,495,946 V1164A possibly damaging Het
Atp6v0d1 A G 8: 105,565,798 C39R probably damaging Het
Bmp8a T A 4: 123,342,399 S104C probably damaging Het
Cand1 T C 10: 119,216,667 T185A probably benign Het
Ccdc171 A G 4: 83,864,323 E1284G probably damaging Het
Chodl A G 16: 78,931,444 S26G possibly damaging Het
Cic C T 7: 25,288,467 P620S probably damaging Het
Col3a1 T C 1: 45,348,677 probably benign Het
Dirc2 T C 16: 35,719,417 M345V probably benign Het
Dpyd G T 3: 118,797,537 G225C probably damaging Het
Dst G A 1: 34,247,691 V5560M probably damaging Het
Eea1 G A 10: 96,039,565 E1233K probably benign Het
Fryl T C 5: 73,088,397 D1139G probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hc T C 2: 35,006,252 D1173G probably benign Het
Htr2a T A 14: 74,641,988 M19K probably benign Het
Kcnt2 G T 1: 140,507,747 C484F probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klhl1 A G 14: 96,517,846 S158P probably benign Het
Ldb2 T C 5: 44,669,407 D62G probably damaging Het
Ldhb T C 6: 142,490,457 K329E possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Olfr1370 A T 13: 21,072,746 I185N probably damaging Het
Olfr178 T C 16: 58,890,176 I15V probably benign Het
Olfr303 T A 7: 86,395,277 T74S possibly damaging Het
Pi4kb T A 3: 94,996,607 H501Q probably benign Het
Ppargc1b T C 18: 61,302,679 K910R probably benign Het
Ppp1r12a G T 10: 108,249,478 R428I probably benign Het
Rbbp8nl G T 2: 180,279,196 T465N possibly damaging Het
Rpl5 T C 5: 107,904,857 F223S possibly damaging Het
Scpep1 T C 11: 88,944,385 K154R probably benign Het
Sil1 T C 18: 35,317,875 Y249C probably benign Het
Slc12a1 T A 2: 125,226,044 L1017Q probably damaging Het
Slc2a9 T C 5: 38,398,811 N264S probably benign Het
Tdrd5 T A 1: 156,300,764 M141L probably benign Het
Tdrd9 T C 12: 111,993,825 C182R probably damaging Het
Thap4 T C 1: 93,750,987 probably null Het
Tmem131 T C 1: 36,825,479 T558A probably benign Het
Tnks1bp1 C T 2: 85,062,647 R973* probably null Het
Ulk3 A G 9: 57,593,229 Y307C probably damaging Het
Usp25 T C 16: 77,115,396 L1001P probably damaging Het
Vmn2r80 A T 10: 79,148,930 T39S probably benign Het
Vps33b G A 7: 80,287,907 A468T possibly damaging Het
Wnt9a T C 11: 59,328,537 S130P probably damaging Het
Zfp236 T C 18: 82,636,954 E730G probably benign Het
Zfp689 C A 7: 127,448,753 V36L probably benign Het
Zfp938 A G 10: 82,226,271 S172P possibly damaging Het
Other mutations in Kank4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Kank4 APN 4 98778395 missense probably damaging 0.99
IGL02634:Kank4 APN 4 98778827 missense probably benign 0.06
IGL02883:Kank4 APN 4 98773453 missense possibly damaging 0.87
R0040:Kank4 UTSW 4 98779220 missense probably benign 0.03
R0040:Kank4 UTSW 4 98779220 missense probably benign 0.03
R0081:Kank4 UTSW 4 98778330 missense probably benign 0.02
R0219:Kank4 UTSW 4 98778465 missense probably benign 0.06
R0498:Kank4 UTSW 4 98779636 missense probably benign
R0609:Kank4 UTSW 4 98777105 missense probably damaging 0.99
R0855:Kank4 UTSW 4 98771444 missense probably damaging 1.00
R0865:Kank4 UTSW 4 98774663 splice site probably benign
R0961:Kank4 UTSW 4 98756519 missense probably benign 0.02
R1172:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1173:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1175:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1381:Kank4 UTSW 4 98779938 missense probably damaging 0.98
R1517:Kank4 UTSW 4 98779029 missense possibly damaging 0.83
R1573:Kank4 UTSW 4 98774836 nonsense probably null
R1668:Kank4 UTSW 4 98778896 missense probably damaging 0.98
R2051:Kank4 UTSW 4 98780102 missense probably damaging 0.99
R2253:Kank4 UTSW 4 98779226 missense probably damaging 0.99
R2656:Kank4 UTSW 4 98778957 missense probably damaging 0.99
R3801:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3802:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3804:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3945:Kank4 UTSW 4 98771280 missense probably damaging 1.00
R4172:Kank4 UTSW 4 98779121 missense probably damaging 1.00
R4503:Kank4 UTSW 4 98777098 missense possibly damaging 0.89
R5024:Kank4 UTSW 4 98785661 missense probably damaging 0.99
R5105:Kank4 UTSW 4 98779159 missense probably benign 0.01
R5122:Kank4 UTSW 4 98756567 missense probably damaging 1.00
R5255:Kank4 UTSW 4 98778972 missense probably benign
R5484:Kank4 UTSW 4 98774785 missense probably benign
R5517:Kank4 UTSW 4 98774881 missense probably damaging 1.00
R5550:Kank4 UTSW 4 98771441 missense probably benign 0.27
R5667:Kank4 UTSW 4 98765461 critical splice donor site probably null
R5671:Kank4 UTSW 4 98765461 critical splice donor site probably null
R5865:Kank4 UTSW 4 98771393 missense possibly damaging 0.50
R6176:Kank4 UTSW 4 98765554 missense probably damaging 1.00
R6778:Kank4 UTSW 4 98761505 missense probably benign 0.01
R7084:Kank4 UTSW 4 98771345 missense probably damaging 1.00
R7085:Kank4 UTSW 4 98779946 missense probably benign
R7112:Kank4 UTSW 4 98761521 missense probably damaging 0.99
X0027:Kank4 UTSW 4 98779923 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGGGATTGAGTCCTGCAG -3'
(R):5'- ATTGAGCATGAGGGCCTCTG -3'

Sequencing Primer
(F):5'- ACAGATGTGTTTCCTAGGGAAG -3'
(R):5'- CATCTGGTCTGCATTACC -3'
Posted On2015-07-21