Incidental Mutation 'R4502:Ldb2'
ID331848
Institutional Source Beutler Lab
Gene Symbol Ldb2
Ensembl Gene ENSMUSG00000039706
Gene NameLIM domain binding 2
SynonymsCLIM1, CLP-36, Ldb3, CLIM-1b, CLIM-1a
MMRRC Submission 041754-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4502 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location44472132-44799680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44669407 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 62 (D62G)
Ref Sequence ENSEMBL: ENSMUSP00000143289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070748] [ENSMUST00000199256] [ENSMUST00000199261] [ENSMUST00000199534]
Predicted Effect probably damaging
Transcript: ENSMUST00000070748
AA Change: D62G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067737
Gene: ENSMUSG00000039706
AA Change: D62G

DomainStartEndE-ValueType
Pfam:LIM_bind 30 232 9.9e-56 PFAM
low complexity region 249 281 N/A INTRINSIC
PDB:2JTN|A 293 337 2e-21 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198894
Predicted Effect probably damaging
Transcript: ENSMUST00000199256
AA Change: D62G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143775
Gene: ENSMUSG00000039706
AA Change: D62G

DomainStartEndE-ValueType
Pfam:LIM_bind 30 232 6.9e-56 PFAM
low complexity region 249 281 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199261
AA Change: D62G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143289
Gene: ENSMUSG00000039706
AA Change: D62G

DomainStartEndE-ValueType
Pfam:LIM_bind 29 233 2.3e-68 PFAM
low complexity region 249 281 N/A INTRINSIC
PDB:2YPA|D 296 335 2e-20 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000199534
AA Change: D62G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142442
Gene: ENSMUSG00000039706
AA Change: D62G

DomainStartEndE-ValueType
Pfam:LIM_bind 29 233 2e-71 PFAM
low complexity region 249 281 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the LIM-domain binding family. Members of this family are characterized by a conserved nuclear localization sequence, an amino-terminal homodimerization domain and a carboxy-terminal LIM interaction domain. These proteins function as adapter molecules to allow assembly of transcriptional regulatory complexes. Genetic association studies suggest functions for this gene in rhegmatogenous retinal detachment and coronary artery disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous mutation of this gene results in no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b A C 3: 20,315,798 Y215D probably damaging Het
Arf5 T C 6: 28,425,776 V123A possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atm A G 9: 53,495,946 V1164A possibly damaging Het
Atp6v0d1 A G 8: 105,565,798 C39R probably damaging Het
Bmp8a T A 4: 123,342,399 S104C probably damaging Het
Cand1 T C 10: 119,216,667 T185A probably benign Het
Ccdc171 A G 4: 83,864,323 E1284G probably damaging Het
Chodl A G 16: 78,931,444 S26G possibly damaging Het
Cic C T 7: 25,288,467 P620S probably damaging Het
Col3a1 T C 1: 45,348,677 probably benign Het
Dirc2 T C 16: 35,719,417 M345V probably benign Het
Dpyd G T 3: 118,797,537 G225C probably damaging Het
Dst G A 1: 34,247,691 V5560M probably damaging Het
Eea1 G A 10: 96,039,565 E1233K probably benign Het
Fryl T C 5: 73,088,397 D1139G probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hc T C 2: 35,006,252 D1173G probably benign Het
Htr2a T A 14: 74,641,988 M19K probably benign Het
Kank4 G A 4: 98,777,098 S653L possibly damaging Het
Kcnt2 G T 1: 140,507,747 C484F probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klhl1 A G 14: 96,517,846 S158P probably benign Het
Ldhb T C 6: 142,490,457 K329E possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Olfr1370 A T 13: 21,072,746 I185N probably damaging Het
Olfr178 T C 16: 58,890,176 I15V probably benign Het
Olfr303 T A 7: 86,395,277 T74S possibly damaging Het
Pi4kb T A 3: 94,996,607 H501Q probably benign Het
Ppargc1b T C 18: 61,302,679 K910R probably benign Het
Ppp1r12a G T 10: 108,249,478 R428I probably benign Het
Rbbp8nl G T 2: 180,279,196 T465N possibly damaging Het
Rpl5 T C 5: 107,904,857 F223S possibly damaging Het
Scpep1 T C 11: 88,944,385 K154R probably benign Het
Sil1 T C 18: 35,317,875 Y249C probably benign Het
Slc12a1 T A 2: 125,226,044 L1017Q probably damaging Het
Slc2a9 T C 5: 38,398,811 N264S probably benign Het
Tdrd5 T A 1: 156,300,764 M141L probably benign Het
Tdrd9 T C 12: 111,993,825 C182R probably damaging Het
Thap4 T C 1: 93,750,987 probably null Het
Tmem131 T C 1: 36,825,479 T558A probably benign Het
Tnks1bp1 C T 2: 85,062,647 R973* probably null Het
Ulk3 A G 9: 57,593,229 Y307C probably damaging Het
Usp25 T C 16: 77,115,396 L1001P probably damaging Het
Vmn2r80 A T 10: 79,148,930 T39S probably benign Het
Vps33b G A 7: 80,287,907 A468T possibly damaging Het
Wnt9a T C 11: 59,328,537 S130P probably damaging Het
Zfp236 T C 18: 82,636,954 E730G probably benign Het
Zfp689 C A 7: 127,448,753 V36L probably benign Het
Zfp938 A G 10: 82,226,271 S172P possibly damaging Het
Other mutations in Ldb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Ldb2 APN 5 44541684 splice site probably null
IGL01757:Ldb2 APN 5 44541867 splice site probably benign
IGL01936:Ldb2 APN 5 44480244 missense probably damaging 1.00
IGL03105:Ldb2 APN 5 44799373 missense possibly damaging 0.70
IGL03108:Ldb2 APN 5 44541715 missense probably damaging 1.00
R0152:Ldb2 UTSW 5 44541799 missense possibly damaging 0.86
R0178:Ldb2 UTSW 5 44473499 missense probably damaging 1.00
R0841:Ldb2 UTSW 5 44532674 missense probably damaging 1.00
R1145:Ldb2 UTSW 5 44532674 missense probably damaging 1.00
R1145:Ldb2 UTSW 5 44532674 missense probably damaging 1.00
R1318:Ldb2 UTSW 5 44535037 critical splice donor site probably null
R1607:Ldb2 UTSW 5 44473472 missense probably damaging 0.99
R2863:Ldb2 UTSW 5 44480324 missense probably damaging 0.99
R3803:Ldb2 UTSW 5 44473394 missense probably benign 0.38
R4613:Ldb2 UTSW 5 44476551 missense probably benign 0.27
R4985:Ldb2 UTSW 5 44480303 missense probably damaging 1.00
R5475:Ldb2 UTSW 5 44541832 missense probably damaging 1.00
R5512:Ldb2 UTSW 5 44480244 missense probably damaging 1.00
R6058:Ldb2 UTSW 5 44476563 missense possibly damaging 0.66
R6282:Ldb2 UTSW 5 44532665 missense probably damaging 1.00
R6438:Ldb2 UTSW 5 44480310 missense probably damaging 0.98
R6770:Ldb2 UTSW 5 44669396 missense probably damaging 0.99
R6830:Ldb2 UTSW 5 44541857 missense probably damaging 1.00
X0026:Ldb2 UTSW 5 44532728 missense probably damaging 0.99
X0028:Ldb2 UTSW 5 44541794 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGCCTCAGAAGGGAGTCTC -3'
(R):5'- GCTAAGTAAGGAGCCATGATTTTG -3'

Sequencing Primer
(F):5'- CCTCAGAAGGGAGTCTCACAATG -3'
(R):5'- AAGTAAGGAGCCATGATTTTGGTTTG -3'
Posted On2015-07-21