Incidental Mutation 'R4502:Rpl5'
ID331850
Institutional Source Beutler Lab
Gene Symbol Rpl5
Ensembl Gene ENSMUSG00000058558
Gene Nameribosomal protein L5
SynonymsU21RNA
MMRRC Submission 041754-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R4502 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location107900502-107909005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107904857 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 223 (F223S)
Ref Sequence ENSEMBL: ENSMUSP00000080854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031198] [ENSMUST00000082223] [ENSMUST00000145239] [ENSMUST00000153590]
Predicted Effect probably benign
Transcript: ENSMUST00000031198
SMART Domains Protein: ENSMUSP00000031198
Gene: ENSMUSG00000029270

DomainStartEndE-ValueType
PIP49_N 19 177 1.7e-92 SMART
Pfam:PIP49_C 194 396 1.9e-69 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000082223
AA Change: F223S

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080854
Gene: ENSMUSG00000058558
AA Change: F223S

DomainStartEndE-ValueType
low complexity region 19 24 N/A INTRINSIC
Pfam:Ribosomal_L18p 26 173 2.1e-46 PFAM
Pfam:Ribosomal_L18_c 192 283 2.2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140659
Predicted Effect probably benign
Transcript: ENSMUST00000145239
SMART Domains Protein: ENSMUSP00000117801
Gene: ENSMUSG00000029270

DomainStartEndE-ValueType
PIP49_N 1 132 1.18e-45 SMART
Pfam:PIP49_C 149 284 2e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151767
Predicted Effect probably benign
Transcript: ENSMUST00000153590
SMART Domains Protein: ENSMUSP00000123474
Gene: ENSMUSG00000058558

DomainStartEndE-ValueType
Pfam:Ribosomal_L18p 1 123 6.3e-37 PFAM
Pfam:Ribosomal_L18_c 142 163 2.7e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L18P family of ribosomal proteins. It is located in the cytoplasm. The protein binds 5S rRNA to form a stable complex called the 5S ribonucleoprotein particle (RNP), which is necessary for the transport of nonribosome-associated cytoplasmic 5S rRNA to the nucleolus for assembly into ribosomes. The protein interacts specifically with the beta subunit of casein kinase II. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. This gene is co-transcribed with the small nucleolar RNA gene U21, which is located in its fifth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b A C 3: 20,315,798 Y215D probably damaging Het
Arf5 T C 6: 28,425,776 V123A possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atm A G 9: 53,495,946 V1164A possibly damaging Het
Atp6v0d1 A G 8: 105,565,798 C39R probably damaging Het
Bmp8a T A 4: 123,342,399 S104C probably damaging Het
Cand1 T C 10: 119,216,667 T185A probably benign Het
Ccdc171 A G 4: 83,864,323 E1284G probably damaging Het
Chodl A G 16: 78,931,444 S26G possibly damaging Het
Cic C T 7: 25,288,467 P620S probably damaging Het
Col3a1 T C 1: 45,348,677 probably benign Het
Dirc2 T C 16: 35,719,417 M345V probably benign Het
Dpyd G T 3: 118,797,537 G225C probably damaging Het
Dst G A 1: 34,247,691 V5560M probably damaging Het
Eea1 G A 10: 96,039,565 E1233K probably benign Het
Fryl T C 5: 73,088,397 D1139G probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hc T C 2: 35,006,252 D1173G probably benign Het
Htr2a T A 14: 74,641,988 M19K probably benign Het
Kank4 G A 4: 98,777,098 S653L possibly damaging Het
Kcnt2 G T 1: 140,507,747 C484F probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klhl1 A G 14: 96,517,846 S158P probably benign Het
Ldb2 T C 5: 44,669,407 D62G probably damaging Het
Ldhb T C 6: 142,490,457 K329E possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Olfr1370 A T 13: 21,072,746 I185N probably damaging Het
Olfr178 T C 16: 58,890,176 I15V probably benign Het
Olfr303 T A 7: 86,395,277 T74S possibly damaging Het
Pi4kb T A 3: 94,996,607 H501Q probably benign Het
Ppargc1b T C 18: 61,302,679 K910R probably benign Het
Ppp1r12a G T 10: 108,249,478 R428I probably benign Het
Rbbp8nl G T 2: 180,279,196 T465N possibly damaging Het
Scpep1 T C 11: 88,944,385 K154R probably benign Het
Sil1 T C 18: 35,317,875 Y249C probably benign Het
Slc12a1 T A 2: 125,226,044 L1017Q probably damaging Het
Slc2a9 T C 5: 38,398,811 N264S probably benign Het
Tdrd5 T A 1: 156,300,764 M141L probably benign Het
Tdrd9 T C 12: 111,993,825 C182R probably damaging Het
Thap4 T C 1: 93,750,987 probably null Het
Tmem131 T C 1: 36,825,479 T558A probably benign Het
Tnks1bp1 C T 2: 85,062,647 R973* probably null Het
Ulk3 A G 9: 57,593,229 Y307C probably damaging Het
Usp25 T C 16: 77,115,396 L1001P probably damaging Het
Vmn2r80 A T 10: 79,148,930 T39S probably benign Het
Vps33b G A 7: 80,287,907 A468T possibly damaging Het
Wnt9a T C 11: 59,328,537 S130P probably damaging Het
Zfp236 T C 18: 82,636,954 E730G probably benign Het
Zfp689 C A 7: 127,448,753 V36L probably benign Het
Zfp938 A G 10: 82,226,271 S172P possibly damaging Het
Other mutations in Rpl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Rpl5 APN 5 107907279 critical splice donor site probably null
IGL01694:Rpl5 APN 5 107907240 missense probably benign 0.00
PIT4142001:Rpl5 UTSW 5 107907183 unclassified probably benign
R0070:Rpl5 UTSW 5 107901900 missense probably benign 0.13
R0153:Rpl5 UTSW 5 107904757 missense probably benign 0.00
R3877:Rpl5 UTSW 5 107903801 missense probably benign 0.14
R4503:Rpl5 UTSW 5 107904857 missense possibly damaging 0.92
R5654:Rpl5 UTSW 5 107903648 intron probably benign
R6955:Rpl5 UTSW 5 107902046 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGAAGTGAATTCCTGGGAGTG -3'
(R):5'- TTCCCGCCTGACCAATATAC -3'

Sequencing Primer
(F):5'- AATTCCTGGGAGTGTTGTAATTTC -3'
(R):5'- GCCTGACCAATATACTAACTTCACTC -3'
Posted On2015-07-21