Incidental Mutation 'R4502:Olfr303'
ID331856
Institutional Source Beutler Lab
Gene Symbol Olfr303
Ensembl Gene ENSMUSG00000039608
Gene Nameolfactory receptor 303
SynonymsGA_x6K02T2NHDJ-9712819-9713778, MOR104-2
MMRRC Submission 041754-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4502 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86391810-86397789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86395277 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 74 (T74S)
Ref Sequence ENSEMBL: ENSMUSP00000149419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053958] [ENSMUST00000215234] [ENSMUST00000215532] [ENSMUST00000215733] [ENSMUST00000216409]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053958
AA Change: T74S

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000062459
Gene: ENSMUSG00000039608
AA Change: T74S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-52 PFAM
Pfam:7tm_1 41 307 4.9e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215234
AA Change: T74S

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215532
AA Change: T74S

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215733
AA Change: T74S

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216409
AA Change: T74S

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b A C 3: 20,315,798 Y215D probably damaging Het
Arf5 T C 6: 28,425,776 V123A possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atm A G 9: 53,495,946 V1164A possibly damaging Het
Atp6v0d1 A G 8: 105,565,798 C39R probably damaging Het
Bmp8a T A 4: 123,342,399 S104C probably damaging Het
Cand1 T C 10: 119,216,667 T185A probably benign Het
Ccdc171 A G 4: 83,864,323 E1284G probably damaging Het
Chodl A G 16: 78,931,444 S26G possibly damaging Het
Cic C T 7: 25,288,467 P620S probably damaging Het
Col3a1 T C 1: 45,348,677 probably benign Het
Dirc2 T C 16: 35,719,417 M345V probably benign Het
Dpyd G T 3: 118,797,537 G225C probably damaging Het
Dst G A 1: 34,247,691 V5560M probably damaging Het
Eea1 G A 10: 96,039,565 E1233K probably benign Het
Fryl T C 5: 73,088,397 D1139G probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hc T C 2: 35,006,252 D1173G probably benign Het
Htr2a T A 14: 74,641,988 M19K probably benign Het
Kank4 G A 4: 98,777,098 S653L possibly damaging Het
Kcnt2 G T 1: 140,507,747 C484F probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klhl1 A G 14: 96,517,846 S158P probably benign Het
Ldb2 T C 5: 44,669,407 D62G probably damaging Het
Ldhb T C 6: 142,490,457 K329E possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Olfr1370 A T 13: 21,072,746 I185N probably damaging Het
Olfr178 T C 16: 58,890,176 I15V probably benign Het
Pi4kb T A 3: 94,996,607 H501Q probably benign Het
Ppargc1b T C 18: 61,302,679 K910R probably benign Het
Ppp1r12a G T 10: 108,249,478 R428I probably benign Het
Rbbp8nl G T 2: 180,279,196 T465N possibly damaging Het
Rpl5 T C 5: 107,904,857 F223S possibly damaging Het
Scpep1 T C 11: 88,944,385 K154R probably benign Het
Sil1 T C 18: 35,317,875 Y249C probably benign Het
Slc12a1 T A 2: 125,226,044 L1017Q probably damaging Het
Slc2a9 T C 5: 38,398,811 N264S probably benign Het
Tdrd5 T A 1: 156,300,764 M141L probably benign Het
Tdrd9 T C 12: 111,993,825 C182R probably damaging Het
Thap4 T C 1: 93,750,987 probably null Het
Tmem131 T C 1: 36,825,479 T558A probably benign Het
Tnks1bp1 C T 2: 85,062,647 R973* probably null Het
Ulk3 A G 9: 57,593,229 Y307C probably damaging Het
Usp25 T C 16: 77,115,396 L1001P probably damaging Het
Vmn2r80 A T 10: 79,148,930 T39S probably benign Het
Vps33b G A 7: 80,287,907 A468T possibly damaging Het
Wnt9a T C 11: 59,328,537 S130P probably damaging Het
Zfp236 T C 18: 82,636,954 E730G probably benign Het
Zfp689 C A 7: 127,448,753 V36L probably benign Het
Zfp938 A G 10: 82,226,271 S172P possibly damaging Het
Other mutations in Olfr303
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02228:Olfr303 APN 7 86395078 missense possibly damaging 0.50
IGL02902:Olfr303 APN 7 86394535 utr 3 prime probably benign
IGL02937:Olfr303 APN 7 86394590 missense possibly damaging 0.89
R1455:Olfr303 UTSW 7 86394595 missense probably damaging 0.97
R1524:Olfr303 UTSW 7 86394812 missense probably benign 0.01
R1762:Olfr303 UTSW 7 86395145 missense probably damaging 0.97
R3014:Olfr303 UTSW 7 86394676 missense probably benign 0.19
R3027:Olfr303 UTSW 7 86394553 missense probably benign 0.00
R4073:Olfr303 UTSW 7 86394947 missense probably damaging 0.98
R4503:Olfr303 UTSW 7 86395277 missense possibly damaging 0.49
R4607:Olfr303 UTSW 7 86394510 utr 3 prime probably null
R4608:Olfr303 UTSW 7 86394510 utr 3 prime probably null
R7134:Olfr303 UTSW 7 86395544 start gained probably benign
R7298:Olfr303 UTSW 7 86394923 missense probably damaging 1.00
R7827:Olfr303 UTSW 7 86394557 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATGATGCAGCTGAAAACC -3'
(R):5'- TTCTAGGGTTTCCAGGCTCC -3'

Sequencing Primer
(F):5'- CTGAAAACCTCAGGCAAATGTG -3'
(R):5'- AGGCTCCTCTTCACTGCAG -3'
Posted On2015-07-21