Incidental Mutation 'R4502:Atp6v0d1'
ID331859
Institutional Source Beutler Lab
Gene Symbol Atp6v0d1
Ensembl Gene ENSMUSG00000013160
Gene NameATPase, H+ transporting, lysosomal V0 subunit D1
SynonymsAc39, P39, Vma6, lysosomal 38kDa, Atp6d
MMRRC Submission 041754-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4502 (G1)
Quality Score169
Status Not validated
Chromosome8
Chromosomal Location105524465-105566047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105565798 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 39 (C39R)
Ref Sequence ENSEMBL: ENSMUSP00000013304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005849] [ENSMUST00000013304] [ENSMUST00000194091] [ENSMUST00000194654]
Predicted Effect probably benign
Transcript: ENSMUST00000005849
SMART Domains Protein: ENSMUSP00000005849
Gene: ENSMUSG00000005705

DomainStartEndE-ValueType
Agouti 1 121 2.01e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000013304
AA Change: C39R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013304
Gene: ENSMUSG00000013160
AA Change: C39R

DomainStartEndE-ValueType
Pfam:vATP-synt_AC39 16 347 2.4e-116 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192691
Predicted Effect probably benign
Transcript: ENSMUST00000194091
SMART Domains Protein: ENSMUSP00000142044
Gene: ENSMUSG00000005705

DomainStartEndE-ValueType
Agouti 1 121 2.01e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194654
SMART Domains Protein: ENSMUSP00000141783
Gene: ENSMUSG00000005705

DomainStartEndE-ValueType
Agouti 1 118 1.2e-54 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195108
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is known as the D subunit and is found ubiquitously. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b A C 3: 20,315,798 Y215D probably damaging Het
Arf5 T C 6: 28,425,776 V123A possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atm A G 9: 53,495,946 V1164A possibly damaging Het
Bmp8a T A 4: 123,342,399 S104C probably damaging Het
Cand1 T C 10: 119,216,667 T185A probably benign Het
Ccdc171 A G 4: 83,864,323 E1284G probably damaging Het
Chodl A G 16: 78,931,444 S26G possibly damaging Het
Cic C T 7: 25,288,467 P620S probably damaging Het
Col3a1 T C 1: 45,348,677 probably benign Het
Dirc2 T C 16: 35,719,417 M345V probably benign Het
Dpyd G T 3: 118,797,537 G225C probably damaging Het
Dst G A 1: 34,247,691 V5560M probably damaging Het
Eea1 G A 10: 96,039,565 E1233K probably benign Het
Fryl T C 5: 73,088,397 D1139G probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hc T C 2: 35,006,252 D1173G probably benign Het
Htr2a T A 14: 74,641,988 M19K probably benign Het
Kank4 G A 4: 98,777,098 S653L possibly damaging Het
Kcnt2 G T 1: 140,507,747 C484F probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klhl1 A G 14: 96,517,846 S158P probably benign Het
Ldb2 T C 5: 44,669,407 D62G probably damaging Het
Ldhb T C 6: 142,490,457 K329E possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Olfr1370 A T 13: 21,072,746 I185N probably damaging Het
Olfr178 T C 16: 58,890,176 I15V probably benign Het
Olfr303 T A 7: 86,395,277 T74S possibly damaging Het
Pi4kb T A 3: 94,996,607 H501Q probably benign Het
Ppargc1b T C 18: 61,302,679 K910R probably benign Het
Ppp1r12a G T 10: 108,249,478 R428I probably benign Het
Rbbp8nl G T 2: 180,279,196 T465N possibly damaging Het
Rpl5 T C 5: 107,904,857 F223S possibly damaging Het
Scpep1 T C 11: 88,944,385 K154R probably benign Het
Sil1 T C 18: 35,317,875 Y249C probably benign Het
Slc12a1 T A 2: 125,226,044 L1017Q probably damaging Het
Slc2a9 T C 5: 38,398,811 N264S probably benign Het
Tdrd5 T A 1: 156,300,764 M141L probably benign Het
Tdrd9 T C 12: 111,993,825 C182R probably damaging Het
Thap4 T C 1: 93,750,987 probably null Het
Tmem131 T C 1: 36,825,479 T558A probably benign Het
Tnks1bp1 C T 2: 85,062,647 R973* probably null Het
Ulk3 A G 9: 57,593,229 Y307C probably damaging Het
Usp25 T C 16: 77,115,396 L1001P probably damaging Het
Vmn2r80 A T 10: 79,148,930 T39S probably benign Het
Vps33b G A 7: 80,287,907 A468T possibly damaging Het
Wnt9a T C 11: 59,328,537 S130P probably damaging Het
Zfp236 T C 18: 82,636,954 E730G probably benign Het
Zfp689 C A 7: 127,448,753 V36L probably benign Het
Zfp938 A G 10: 82,226,271 S172P possibly damaging Het
Other mutations in Atp6v0d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03088:Atp6v0d1 APN 8 105530959 missense probably damaging 1.00
R1954:Atp6v0d1 UTSW 8 105565893 missense probably damaging 0.97
R6243:Atp6v0d1 UTSW 8 105565863 missense probably benign 0.26
R6539:Atp6v0d1 UTSW 8 105524974 missense probably benign 0.26
R6961:Atp6v0d1 UTSW 8 105529217 missense probably damaging 1.00
R7246:Atp6v0d1 UTSW 8 105530974 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGCTCGACGAGGTTAGAG -3'
(R):5'- TCACCTGACGCACTTGACAG -3'

Sequencing Primer
(F):5'- CACTGCGGTTCTTGAAGGC -3'
(R):5'- TCAGCTGATCCGGGGAGTCTAG -3'
Posted On2015-07-21