Incidental Mutation 'R4502:Eea1'
ID331865
Institutional Source Beutler Lab
Gene Symbol Eea1
Ensembl Gene ENSMUSG00000036499
Gene Nameearly endosome antigen 1
SynonymsZFYVE2, B230358H09Rik, A430109M19Rik
MMRRC Submission 041754-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R4502 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location95940650-96045518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96039565 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1233 (E1233K)
Ref Sequence ENSEMBL: ENSMUSP00000061493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053484]
Predicted Effect probably benign
Transcript: ENSMUST00000053484
AA Change: E1233K

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000061493
Gene: ENSMUSG00000036499
AA Change: E1233K

DomainStartEndE-ValueType
ZnF_C2H2 41 64 2.2e-2 SMART
low complexity region 98 123 N/A INTRINSIC
low complexity region 135 148 N/A INTRINSIC
low complexity region 389 408 N/A INTRINSIC
low complexity region 480 500 N/A INTRINSIC
low complexity region 573 585 N/A INTRINSIC
low complexity region 616 630 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 748 760 N/A INTRINSIC
low complexity region 909 924 N/A INTRINSIC
low complexity region 947 958 N/A INTRINSIC
low complexity region 996 1010 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1198 1217 N/A INTRINSIC
FYVE 1344 1411 1.99e-28 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b A C 3: 20,315,798 Y215D probably damaging Het
Arf5 T C 6: 28,425,776 V123A possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atm A G 9: 53,495,946 V1164A possibly damaging Het
Atp6v0d1 A G 8: 105,565,798 C39R probably damaging Het
Bmp8a T A 4: 123,342,399 S104C probably damaging Het
Cand1 T C 10: 119,216,667 T185A probably benign Het
Ccdc171 A G 4: 83,864,323 E1284G probably damaging Het
Chodl A G 16: 78,931,444 S26G possibly damaging Het
Cic C T 7: 25,288,467 P620S probably damaging Het
Col3a1 T C 1: 45,348,677 probably benign Het
Dirc2 T C 16: 35,719,417 M345V probably benign Het
Dpyd G T 3: 118,797,537 G225C probably damaging Het
Dst G A 1: 34,247,691 V5560M probably damaging Het
Fryl T C 5: 73,088,397 D1139G probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hc T C 2: 35,006,252 D1173G probably benign Het
Htr2a T A 14: 74,641,988 M19K probably benign Het
Kank4 G A 4: 98,777,098 S653L possibly damaging Het
Kcnt2 G T 1: 140,507,747 C484F probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klhl1 A G 14: 96,517,846 S158P probably benign Het
Ldb2 T C 5: 44,669,407 D62G probably damaging Het
Ldhb T C 6: 142,490,457 K329E possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Olfr1370 A T 13: 21,072,746 I185N probably damaging Het
Olfr178 T C 16: 58,890,176 I15V probably benign Het
Olfr303 T A 7: 86,395,277 T74S possibly damaging Het
Pi4kb T A 3: 94,996,607 H501Q probably benign Het
Ppargc1b T C 18: 61,302,679 K910R probably benign Het
Ppp1r12a G T 10: 108,249,478 R428I probably benign Het
Rbbp8nl G T 2: 180,279,196 T465N possibly damaging Het
Rpl5 T C 5: 107,904,857 F223S possibly damaging Het
Scpep1 T C 11: 88,944,385 K154R probably benign Het
Sil1 T C 18: 35,317,875 Y249C probably benign Het
Slc12a1 T A 2: 125,226,044 L1017Q probably damaging Het
Slc2a9 T C 5: 38,398,811 N264S probably benign Het
Tdrd5 T A 1: 156,300,764 M141L probably benign Het
Tdrd9 T C 12: 111,993,825 C182R probably damaging Het
Thap4 T C 1: 93,750,987 probably null Het
Tmem131 T C 1: 36,825,479 T558A probably benign Het
Tnks1bp1 C T 2: 85,062,647 R973* probably null Het
Ulk3 A G 9: 57,593,229 Y307C probably damaging Het
Usp25 T C 16: 77,115,396 L1001P probably damaging Het
Vmn2r80 A T 10: 79,148,930 T39S probably benign Het
Vps33b G A 7: 80,287,907 A468T possibly damaging Het
Wnt9a T C 11: 59,328,537 S130P probably damaging Het
Zfp236 T C 18: 82,636,954 E730G probably benign Het
Zfp689 C A 7: 127,448,753 V36L probably benign Het
Zfp938 A G 10: 82,226,271 S172P possibly damaging Het
Other mutations in Eea1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Eea1 APN 10 96031677 missense probably damaging 0.99
IGL01645:Eea1 APN 10 95989589 missense probably damaging 1.00
IGL01646:Eea1 APN 10 95997015 missense probably damaging 0.99
IGL01870:Eea1 APN 10 95973986 missense probably damaging 1.00
IGL02074:Eea1 APN 10 96037487 missense probably damaging 1.00
IGL02229:Eea1 APN 10 96018184 missense probably damaging 1.00
IGL02885:Eea1 APN 10 96041484 missense probably benign 0.04
IGL02971:Eea1 APN 10 96041527 missense probably benign 0.37
IGL03223:Eea1 APN 10 96039611 missense probably damaging 1.00
IGL03355:Eea1 APN 10 96042212 utr 3 prime probably benign
Senior UTSW 10 96011037 missense probably benign
Slump UTSW 10 96036633 missense probably benign 0.00
R0189:Eea1 UTSW 10 95995582 missense possibly damaging 0.86
R0374:Eea1 UTSW 10 96039772 splice site probably benign
R0655:Eea1 UTSW 10 95995598 missense probably benign 0.00
R0883:Eea1 UTSW 10 96021667 missense possibly damaging 0.63
R1219:Eea1 UTSW 10 96010761 splice site probably benign
R1344:Eea1 UTSW 10 95994999 critical splice donor site probably null
R1768:Eea1 UTSW 10 95996960 missense probably damaging 1.00
R1887:Eea1 UTSW 10 96018211 critical splice donor site probably null
R2224:Eea1 UTSW 10 96020012 missense probably damaging 0.99
R2927:Eea1 UTSW 10 96013358 missense probably benign 0.00
R3922:Eea1 UTSW 10 96036633 missense probably benign 0.00
R3950:Eea1 UTSW 10 96042134 missense probably damaging 1.00
R4647:Eea1 UTSW 10 96028393 missense probably benign
R4876:Eea1 UTSW 10 95995613 missense probably benign 0.07
R5009:Eea1 UTSW 10 96011021 missense probably benign
R5018:Eea1 UTSW 10 96011037 missense probably benign
R5490:Eea1 UTSW 10 96026054 missense probably benign 0.41
R5588:Eea1 UTSW 10 96023910 missense probably benign 0.01
R5791:Eea1 UTSW 10 96019995 missense probably benign 0.24
R5799:Eea1 UTSW 10 96002948 missense possibly damaging 0.81
R5842:Eea1 UTSW 10 96018124 missense probably damaging 1.00
R6332:Eea1 UTSW 10 96041473 missense possibly damaging 0.79
R6376:Eea1 UTSW 10 96038798 missense probably benign 0.01
R6468:Eea1 UTSW 10 96028412 missense probably benign 0.14
R6740:Eea1 UTSW 10 96023993 missense probably benign
R6889:Eea1 UTSW 10 96037478 missense probably benign 0.14
R6904:Eea1 UTSW 10 96002879 splice site probably null
R7269:Eea1 UTSW 10 96018138 missense probably damaging 1.00
R7273:Eea1 UTSW 10 95989631 missense probably benign 0.00
R7398:Eea1 UTSW 10 95995631 missense probably benign
R7400:Eea1 UTSW 10 95995570 missense probably benign 0.02
R7537:Eea1 UTSW 10 95994905 nonsense probably null
R7687:Eea1 UTSW 10 96026598 missense probably benign
R7762:Eea1 UTSW 10 96028439 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ATCACACATTTGGGTTGCAGAATC -3'
(R):5'- AGGAGTGCTCTTCTTTCGTC -3'

Sequencing Primer
(F):5'- CATTTGGGTTGCAGAATCAGAATTG -3'
(R):5'- CGTCTTGATTATTCTGAACAGTTGC -3'
Posted On2015-07-21