Mutagenetix > Incidental Mutation

Incidental Mutation 'R4503:Sall2'

331902

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4503 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 52313459 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 758 (M758V)

Ref Sequence

ENSEMBL: ENSMUSP00000154331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

probably benign
Transcript: ENSMUST00000058326
AA Change: M760V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: M760V

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135523
AA Change: M758V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam21	A	G	12: 81,560,898	L30P	probably benign	Het
Adamts20	T	C	15: 94,379,750	H277R	probably damaging	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Atp13a5	G	T	16: 29,293,528	N598K	probably benign	Het
Ccdc171	A	G	4: 83,864,323	E1284G	probably damaging	Het
Cdk5	G	A	5: 24,419,619	T258M	possibly damaging	Het
Col3a1	T	C	1: 45,348,677		probably benign	Het
Coro6	A	G	11: 77,469,446	E414G	probably benign	Het
Dirc2	T	C	16: 35,719,417	M345V	probably benign	Het
Dst	T	C	1: 34,262,253		probably null	Het
Fabp3	C	T	4: 130,312,452		probably null	Het
Gpr39	G	A	1: 125,677,991	V219I	probably benign	Het
Hist2h2bb	A	T	3: 96,269,924	K58M	possibly damaging	Het
Kank4	G	A	4: 98,777,098	S653L	possibly damaging	Het
Mapkbp1	T	C	2: 120,015,706	I451T	probably damaging	Het
Ncf2	A	G	1: 152,833,778	E342G	probably benign	Het
Olfr178	T	C	16: 58,890,176	I15V	probably benign	Het
Olfr303	T	A	7: 86,395,277	T74S	possibly damaging	Het
Pds5b	T	C	5: 150,728,934	L222P	probably damaging	Het
Rpl5	T	C	5: 107,904,857	F223S	possibly damaging	Het
Sacs	A	G	14: 61,207,603	N2366S	probably damaging	Het
Sh3tc2	A	G	18: 61,974,623	E235G	probably damaging	Het
Smad2	T	A	18: 76,302,592	S419T	probably benign	Het
Sprr3	T	C	3: 92,457,376	I54V	possibly damaging	Het
Tbck	A	G	3: 132,751,220	T632A	probably benign	Het
Tmem131	T	C	1: 36,825,479	T558A	probably benign	Het
Tmem178	C	T	17: 80,986,264	T162I	probably benign	Het
Zfp619	A	G	7: 39,536,856	H770R	probably damaging	Het
Zfp938	A	G	10: 82,226,271	S172P	possibly damaging	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- TCCATCTCCTTCACAGTGGTGG -3'
(R):5'- CCTGCCCCATTTGTCAGAAG -3'

Sequencing Primer
(F):5'- ACAGTGGTGGGTGCTGCTAC -3'
(R):5'- GCCCCATTTGTCAGAAGAAGTTC -3'

Posted On

2015-07-21