Incidental Mutation 'R4504:Dstyk'
ID331911
Institutional Source Beutler Lab
Gene Symbol Dstyk
Ensembl Gene ENSMUSG00000042046
Gene Namedual serine/threonine and tyrosine protein kinase
SynonymsC430014H23Rik, A930019K20Rik
MMRRC Submission 041755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R4504 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132417555-132466958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132434389 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 186 (T186A)
Ref Sequence ENSEMBL: ENSMUSP00000035358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045110] [ENSMUST00000188389]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045110
AA Change: T186A

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035358
Gene: ENSMUSG00000042046
AA Change: T186A

DomainStartEndE-ValueType
low complexity region 15 22 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 285 299 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
Pfam:Pkinase_Tyr 651 904 6.9e-37 PFAM
Pfam:Pkinase 651 905 5.1e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188389
AA Change: T186A

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139652
Gene: ENSMUSG00000042046
AA Change: T186A

DomainStartEndE-ValueType
low complexity region 15 22 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 285 299 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
S_TKc 650 859 2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188973
Meta Mutation Damage Score 0.1207 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual serine/threonine and tyrosine protein kinase which is expressed in multiple tissues. It is thought to function as a regulator of cell death. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous knockout results in impaired spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik A G 14: 44,170,442 S45P probably damaging Het
Adgrg4 C T X: 56,916,442 R1124C possibly damaging Het
Anxa13 T C 15: 58,356,203 noncoding transcript Het
Arhgap32 C A 9: 32,181,839 probably null Het
Carm1 T C 9: 21,569,526 F99L probably damaging Het
Dennd1b A G 1: 139,085,927 E253G possibly damaging Het
Dsg4 A G 18: 20,461,436 I541V probably benign Het
Ear1 A T 14: 43,819,264 V49D probably benign Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fndc8 T A 11: 82,892,400 M69K probably benign Het
Gm13023 G C 4: 143,793,983 E102Q probably benign Het
Golga1 T C 2: 39,023,454 I482V probably benign Het
Hivep3 G A 4: 119,733,793 probably benign Het
Igkv13-85 A G 6: 68,930,372 F82L probably damaging Het
Itih1 G A 14: 30,935,885 R410C probably damaging Het
Kcnc2 T C 10: 112,455,794 W296R probably damaging Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Kif3b T C 2: 153,323,644 probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Notch1 A G 2: 26,472,177 V1022A probably benign Het
Npc1l1 A G 11: 6,228,741 L223S possibly damaging Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr279 T C 15: 98,498,134 F221L probably benign Het
Pbxip1 A G 3: 89,446,383 D281G possibly damaging Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Pcsk5 C T 19: 17,451,955 C1553Y probably damaging Het
Pdgfc A C 3: 81,174,991 M164L probably benign Het
Pdzd8 T C 19: 59,345,448 Y47C probably damaging Het
Pip5k1c T A 10: 81,315,111 I633N probably damaging Het
Pkn1 G A 8: 83,692,927 R16* probably null Het
Pole2 A G 12: 69,222,468 V85A probably benign Het
Ppp4c A C 7: 126,787,465 L150R probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Rnf144a T A 12: 26,327,303 R92S probably benign Het
Sbno2 C A 10: 80,060,492 R898L possibly damaging Het
Scnn1b A C 7: 121,912,475 N370T probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Vps13a T C 19: 16,695,502 E1302G possibly damaging Het
Other mutations in Dstyk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Dstyk APN 1 132459988 missense probably damaging 1.00
IGL01753:Dstyk APN 1 132462939 missense probably damaging 1.00
IGL02156:Dstyk APN 1 132449926 missense probably benign 0.27
IGL02175:Dstyk APN 1 132449391 nonsense probably null
IGL02721:Dstyk APN 1 132449316 missense probably benign 0.03
IGL03194:Dstyk APN 1 132456316 splice site probably benign
PIT4305001:Dstyk UTSW 1 132455896 nonsense probably null
PIT4791001:Dstyk UTSW 1 132449927 missense probably benign 0.00
R0135:Dstyk UTSW 1 132462934 missense probably damaging 1.00
R0309:Dstyk UTSW 1 132456864 splice site probably benign
R0399:Dstyk UTSW 1 132453080 splice site probably benign
R0781:Dstyk UTSW 1 132453325 splice site probably benign
R1110:Dstyk UTSW 1 132453325 splice site probably benign
R1138:Dstyk UTSW 1 132463486 missense probably benign 0.00
R1300:Dstyk UTSW 1 132449913 missense probably benign 0.02
R1330:Dstyk UTSW 1 132449880 missense probably benign 0.25
R1509:Dstyk UTSW 1 132456346 missense probably damaging 1.00
R1667:Dstyk UTSW 1 132456919 missense probably damaging 1.00
R1728:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1729:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1730:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1739:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1757:Dstyk UTSW 1 132434094 splice site probably benign
R1762:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1783:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1784:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1785:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1829:Dstyk UTSW 1 132449595 missense probably benign 0.06
R2031:Dstyk UTSW 1 132453191 missense probably damaging 0.99
R2124:Dstyk UTSW 1 132453119 missense possibly damaging 0.64
R2132:Dstyk UTSW 1 132449484 missense probably null
R2143:Dstyk UTSW 1 132463375 missense probably damaging 1.00
R2144:Dstyk UTSW 1 132463375 missense probably damaging 1.00
R2145:Dstyk UTSW 1 132463375 missense probably damaging 1.00
R3804:Dstyk UTSW 1 132449726 missense probably damaging 1.00
R4277:Dstyk UTSW 1 132455413 splice site probably null
R4674:Dstyk UTSW 1 132463390 missense probably benign 0.42
R4697:Dstyk UTSW 1 132449487 missense probably damaging 0.98
R4828:Dstyk UTSW 1 132434137 missense probably benign
R4940:Dstyk UTSW 1 132453106 missense probably damaging 0.96
R5029:Dstyk UTSW 1 132449324 missense probably benign 0.01
R5678:Dstyk UTSW 1 132453291 missense probably benign
R5900:Dstyk UTSW 1 132456979 missense probably damaging 1.00
R5935:Dstyk UTSW 1 132454137 missense probably damaging 0.99
R5973:Dstyk UTSW 1 132434411 missense probably damaging 0.99
R6217:Dstyk UTSW 1 132459939 missense probably damaging 1.00
R6381:Dstyk UTSW 1 132456765 intron probably null
R6429:Dstyk UTSW 1 132449804 nonsense probably null
R7038:Dstyk UTSW 1 132454109 missense probably benign 0.32
R7240:Dstyk UTSW 1 132454123 missense probably benign 0.02
R7411:Dstyk UTSW 1 132417666 missense probably benign 0.01
R7714:Dstyk UTSW 1 132456876 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TATACTGATCCTCGGCCAGG -3'
(R):5'- CGGATTACAGTCCTCTCACC -3'

Sequencing Primer
(F):5'- AAGTGCCAGCTGCTGAAC -3'
(R):5'- GGATTACAGTCCTCTCACCACATG -3'
Posted On2015-07-21