Mutagenetix > Incidental Mutation

Incidental Mutation 'R4504:Golga1'

331915

Institutional Source

Beutler Lab

Gene Symbol

Golga1

Ensembl Gene

ENSMUSG00000026754

Gene Name

golgi autoantigen, golgin subfamily a, 1

Synonyms

0710001G09Rik, Golgi97, golgin-97, 2210418B03Rik

MMRRC Submission

041755-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R4504 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

39016155-39065541 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 39023454 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 482 (I482V)

Ref Sequence

ENSEMBL: ENSMUSP00000108471 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039165] [ENSMUST00000112850] [ENSMUST00000184996]

AlphaFold

Q9CW79

Predicted Effect

probably benign
Transcript: ENSMUST00000039165
AA Change: I507V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000037735
Gene: ENSMUSG00000026754
AA Change: I507V

Domain	Start	End	E-Value	Type
coiled coil region	51	104	N/A	INTRINSIC
coiled coil region	126	169	N/A	INTRINSIC
coiled coil region	190	555	N/A	INTRINSIC
coiled coil region	599	647	N/A	INTRINSIC
Grip	682	728	5.68e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083193

Predicted Effect

probably benign
Transcript: ENSMUST00000112850
AA Change: I482V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000108471
Gene: ENSMUSG00000026754
AA Change: I482V

Domain	Start	End	E-Value	Type
coiled coil region	53	144	N/A	INTRINSIC
coiled coil region	165	530	N/A	INTRINSIC
coiled coil region	574	622	N/A	INTRINSIC
Grip	657	703	5.68e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126520

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149842

Predicted Effect

probably benign
Transcript: ENSMUST00000153914

Predicted Effect

probably benign
Transcript: ENSMUST00000154210

Predicted Effect

probably benign
Transcript: ENSMUST00000184996
AA Change: I507V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000139001
Gene: ENSMUSG00000026754
AA Change: I507V

Domain	Start	End	E-Value	Type
coiled coil region	51	104	N/A	INTRINSIC
coiled coil region	126	169	N/A	INTRINSIC
coiled coil region	190	555	N/A	INTRINSIC
coiled coil region	599	647	N/A	INTRINSIC
Grip	682	728	5.68e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204127

Meta Mutation Damage Score

0.0606

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein is associated with Sjogren's syndrome. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice exhibit tremors and limb grasping behavior at two months of age. A variable severity of hearing loss was also seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503E14Rik	A	G	14: 44,170,442	S45P	probably damaging	Het
Adgrg4	C	T	X: 56,916,442	R1124C	possibly damaging	Het
Anxa13	T	C	15: 58,356,203		noncoding transcript	Het
Arhgap32	C	A	9: 32,181,839		probably null	Het
Carm1	T	C	9: 21,569,526	F99L	probably damaging	Het
Dennd1b	A	G	1: 139,085,927	E253G	possibly damaging	Het
Dsg4	A	G	18: 20,461,436	I541V	probably benign	Het
Dstyk	A	G	1: 132,434,389	T186A	possibly damaging	Het
Ear1	A	T	14: 43,819,264	V49D	probably benign	Het
Epha10	A	G	4: 124,915,687		probably benign	Het
Fbxo18	A	G	2: 11,749,017	V838A	possibly damaging	Het
Fndc8	T	A	11: 82,892,400	M69K	probably benign	Het
Gm13023	G	C	4: 143,793,983	E102Q	probably benign	Het
Hivep3	G	A	4: 119,733,793		probably benign	Het
Igkv13-85	A	G	6: 68,930,372	F82L	probably damaging	Het
Itih1	G	A	14: 30,935,885	R410C	probably damaging	Het
Kcnc2	T	C	10: 112,455,794	W296R	probably damaging	Het
Kcnq3	A	T	15: 65,995,342	Y817*	probably null	Het
Kif3b	T	C	2: 153,323,644		probably null	Het
Krtcap2	A	G	3: 89,246,256		probably benign	Het
Lhx5	C	A	5: 120,440,008	H298N	possibly damaging	Het
Notch1	A	G	2: 26,472,177	V1022A	probably benign	Het
Npc1l1	A	G	11: 6,228,741	L223S	possibly damaging	Het
Olfr1258	C	T	2: 89,930,351	P181S	possibly damaging	Het
Olfr160	C	T	9: 37,711,464	V272I	probably benign	Het
Olfr279	T	C	15: 98,498,134	F221L	probably benign	Het
Pbxip1	A	G	3: 89,446,383	D281G	possibly damaging	Het
Pcdhga8	G	C	18: 37,816,763	V411L	probably damaging	Het
Pcsk5	C	T	19: 17,451,955	C1553Y	probably damaging	Het
Pdgfc	A	C	3: 81,174,991	M164L	probably benign	Het
Pdzd8	T	C	19: 59,345,448	Y47C	probably damaging	Het
Pip5k1c	T	A	10: 81,315,111	I633N	probably damaging	Het
Pkn1	G	A	8: 83,692,927	R16*	probably null	Het
Pole2	A	G	12: 69,222,468	V85A	probably benign	Het
Ppp4c	A	C	7: 126,787,465	L150R	probably damaging	Het
Ric8a	A	G	7: 140,858,516	I223V	probably benign	Het
Rnf144a	T	A	12: 26,327,303	R92S	probably benign	Het
Sbno2	C	A	10: 80,060,492	R898L	possibly damaging	Het
Scnn1b	A	C	7: 121,912,475	N370T	probably damaging	Het
Taar3	A	G	10: 23,949,573	I6V	possibly damaging	Het
Vps13a	T	C	19: 16,695,502	E1302G	possibly damaging	Het

Other mutations in Golga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Golga1	APN	2	39052973	nonsense	probably null
IGL00949:Golga1	APN	2	39041255	missense	probably damaging	0.98
IGL01133:Golga1	APN	2	39023472	missense	probably benign
IGL01592:Golga1	APN	2	39063282	missense	probably damaging	1.00
IGL01613:Golga1	APN	2	39020126	missense	probably benign	0.14
IGL01819:Golga1	APN	2	39034149	missense	probably benign	0.00
IGL01871:Golga1	APN	2	39050198	splice site	probably benign
IGL02744:Golga1	APN	2	39018474	missense	probably damaging	1.00
IGL02819:Golga1	APN	2	39039078	missense	probably null	0.97
IGL02874:Golga1	APN	2	39039092	missense	probably damaging	1.00
R0167:Golga1	UTSW	2	39047648	missense	probably benign	0.00
R0245:Golga1	UTSW	2	39035259	missense	probably benign	0.00
R0389:Golga1	UTSW	2	39018441	missense	probably damaging	1.00
R0443:Golga1	UTSW	2	39018441	missense	probably damaging	1.00
R0906:Golga1	UTSW	2	39047643	missense	probably damaging	0.99
R1508:Golga1	UTSW	2	39023249	missense	probably benign
R1901:Golga1	UTSW	2	39047780	splice site	probably null
R1964:Golga1	UTSW	2	39047087	missense	probably benign	0.00
R2228:Golga1	UTSW	2	39023171	missense	probably benign	0.02
R3734:Golga1	UTSW	2	39050170	missense	possibly damaging	0.88
R4407:Golga1	UTSW	2	39019641	splice site	probably null
R4973:Golga1	UTSW	2	39039106	missense	probably damaging	0.99
R5049:Golga1	UTSW	2	39047735	missense	probably damaging	1.00
R5600:Golga1	UTSW	2	39020099	missense	probably damaging	1.00
R6008:Golga1	UTSW	2	39047087	missense	probably benign	0.00
R6374:Golga1	UTSW	2	39034068	missense	probably benign
R6388:Golga1	UTSW	2	39023171	missense	probably benign	0.02
R6601:Golga1	UTSW	2	39020106	missense	probably damaging	1.00
R7067:Golga1	UTSW	2	39047719	missense	probably benign	0.00
R7816:Golga1	UTSW	2	39052098	missense	probably damaging	1.00
R9277:Golga1	UTSW	2	39024243	missense	probably benign	0.19
R9581:Golga1	UTSW	2	39019561	missense	probably damaging	1.00
X0025:Golga1	UTSW	2	39052062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGCAGAACTGTGACCTAG -3'
(R):5'- CCAGAATATCCACACTCTGGG -3'

Sequencing Primer
(F):5'- ACTGTGACCTAGGGCAGTG -3'
(R):5'- ATCCACACTCTGGGTAGCC -3'

Posted On

2015-07-21