Incidental Mutation 'R4504:Kif3b'
ID331917
Institutional Source Beutler Lab
Gene Symbol Kif3b
Ensembl Gene ENSMUSG00000027475
Gene Namekinesin family member 3B
Synonyms
MMRRC Submission 041755-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4504 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location153291413-153333390 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 153323644 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028977] [ENSMUST00000028977] [ENSMUST00000028977]
Predicted Effect probably null
Transcript: ENSMUST00000028977
SMART Domains Protein: ENSMUSP00000028977
Gene: ENSMUSG00000027475

DomainStartEndE-ValueType
KISc 7 348 6.36e-186 SMART
low complexity region 370 412 N/A INTRINSIC
low complexity region 437 458 N/A INTRINSIC
Blast:KISc 459 535 3e-10 BLAST
low complexity region 537 548 N/A INTRINSIC
Blast:KISc 549 626 4e-27 BLAST
low complexity region 685 697 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000028977
SMART Domains Protein: ENSMUSP00000028977
Gene: ENSMUSG00000027475

DomainStartEndE-ValueType
KISc 7 348 6.36e-186 SMART
low complexity region 370 412 N/A INTRINSIC
low complexity region 437 458 N/A INTRINSIC
Blast:KISc 459 535 3e-10 BLAST
low complexity region 537 548 N/A INTRINSIC
Blast:KISc 549 626 4e-27 BLAST
low complexity region 685 697 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000028977
SMART Domains Protein: ENSMUSP00000028977
Gene: ENSMUSG00000027475

DomainStartEndE-ValueType
KISc 7 348 6.36e-186 SMART
low complexity region 370 412 N/A INTRINSIC
low complexity region 437 458 N/A INTRINSIC
Blast:KISc 459 535 3e-10 BLAST
low complexity region 537 548 N/A INTRINSIC
Blast:KISc 549 626 4e-27 BLAST
low complexity region 685 697 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Meta Mutation Damage Score 0.9502 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a heterodimer with kinesin family member 3A to aid in chromosome movement during mitosis and meiosis. The encoded protein is a plus end-directed microtubule motor and can interact with the SMC3 subunit of the cohesin complex. In addition, the encoded protein may be involved in the intracellular movement of membranous organelles. This protein and kinesin family member 3A form the kinesin II subfamily of the kinesin superfamily. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygoous for a targeted null mutation are growth retarded and display neural tube defects, incomplete embryo turning, randomized left-right assymetry, pericardial edema, and die during the midgestational period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik A G 14: 44,170,442 S45P probably damaging Het
Adgrg4 C T X: 56,916,442 R1124C possibly damaging Het
Anxa13 T C 15: 58,356,203 noncoding transcript Het
Arhgap32 C A 9: 32,181,839 probably null Het
Carm1 T C 9: 21,569,526 F99L probably damaging Het
Dennd1b A G 1: 139,085,927 E253G possibly damaging Het
Dsg4 A G 18: 20,461,436 I541V probably benign Het
Dstyk A G 1: 132,434,389 T186A possibly damaging Het
Ear1 A T 14: 43,819,264 V49D probably benign Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fndc8 T A 11: 82,892,400 M69K probably benign Het
Gm13023 G C 4: 143,793,983 E102Q probably benign Het
Golga1 T C 2: 39,023,454 I482V probably benign Het
Hivep3 G A 4: 119,733,793 probably benign Het
Igkv13-85 A G 6: 68,930,372 F82L probably damaging Het
Itih1 G A 14: 30,935,885 R410C probably damaging Het
Kcnc2 T C 10: 112,455,794 W296R probably damaging Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Notch1 A G 2: 26,472,177 V1022A probably benign Het
Npc1l1 A G 11: 6,228,741 L223S possibly damaging Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr279 T C 15: 98,498,134 F221L probably benign Het
Pbxip1 A G 3: 89,446,383 D281G possibly damaging Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Pcsk5 C T 19: 17,451,955 C1553Y probably damaging Het
Pdgfc A C 3: 81,174,991 M164L probably benign Het
Pdzd8 T C 19: 59,345,448 Y47C probably damaging Het
Pip5k1c T A 10: 81,315,111 I633N probably damaging Het
Pkn1 G A 8: 83,692,927 R16* probably null Het
Pole2 A G 12: 69,222,468 V85A probably benign Het
Ppp4c A C 7: 126,787,465 L150R probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Rnf144a T A 12: 26,327,303 R92S probably benign Het
Sbno2 C A 10: 80,060,492 R898L possibly damaging Het
Scnn1b A C 7: 121,912,475 N370T probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Vps13a T C 19: 16,695,502 E1302G possibly damaging Het
Other mutations in Kif3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Kif3b APN 2 153317131 missense probably damaging 0.99
IGL00927:Kif3b APN 2 153316461 missense possibly damaging 0.89
IGL02121:Kif3b APN 2 153317274 missense probably damaging 0.99
IGL02302:Kif3b APN 2 153316948 missense probably damaging 1.00
IGL02306:Kif3b APN 2 153320652 missense probably damaging 1.00
IGL02348:Kif3b APN 2 153316893 missense probably damaging 0.98
IGL03111:Kif3b APN 2 153330068 missense probably benign 0.00
R1463:Kif3b UTSW 2 153330153 makesense probably null
R1474:Kif3b UTSW 2 153320315 missense probably damaging 1.00
R1485:Kif3b UTSW 2 153322931 splice site probably null
R1538:Kif3b UTSW 2 153317462 small deletion probably benign
R1834:Kif3b UTSW 2 153317485 missense probably benign 0.22
R2371:Kif3b UTSW 2 153322823 missense possibly damaging 0.66
R4051:Kif3b UTSW 2 153323557 missense probably damaging 0.99
R4208:Kif3b UTSW 2 153323557 missense probably damaging 0.99
R4619:Kif3b UTSW 2 153316674 nonsense probably null
R4806:Kif3b UTSW 2 153320368 missense probably damaging 1.00
R4911:Kif3b UTSW 2 153317292 nonsense probably null
R7017:Kif3b UTSW 2 153329724 missense possibly damaging 0.87
R7990:Kif3b UTSW 2 153317463 missense probably benign 0.01
R8056:Kif3b UTSW 2 153330059 missense possibly damaging 0.93
X0026:Kif3b UTSW 2 153316321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTACTTAACCCCATTGGCC -3'
(R):5'- ACTTCTCAAACCTAAATTCCTCTGG -3'

Sequencing Primer
(F):5'- GGCCTCAACATTGTCATC -3'
(R):5'- CTGCCAAGCCTGACAATAGAGTTTG -3'
Posted On2015-07-21