Incidental Mutation 'R4504:Epha10'
ID331921
Institutional Source Beutler Lab
Gene Symbol Epha10
Ensembl Gene ENSMUSG00000028876
Gene NameEph receptor A10
Synonyms
MMRRC Submission 041755-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4504 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location124880899-124917800 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 124915687 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030690] [ENSMUST00000084296]
Predicted Effect probably benign
Transcript: ENSMUST00000030690
SMART Domains Protein: ENSMUSP00000030690
Gene: ENSMUSG00000028873

DomainStartEndE-ValueType
Pfam:Nbl1_Borealin_N 20 76 1.9e-20 PFAM
low complexity region 109 139 N/A INTRINSIC
Pfam:Borealin 148 286 5.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084296
SMART Domains Protein: ENSMUSP00000081319
Gene: ENSMUSG00000028873

DomainStartEndE-ValueType
Pfam:Nbl1_Borealin_N 19 77 2.7e-24 PFAM
low complexity region 109 139 N/A INTRINSIC
Pfam:Borealin 173 286 2.4e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135571
Predicted Effect unknown
Transcript: ENSMUST00000149146
AA Change: T849A
SMART Domains Protein: ENSMUSP00000118801
Gene: ENSMUSG00000028876
AA Change: T849A

DomainStartEndE-ValueType
Pfam:Ephrin_lbd 1 66 2.2e-25 PFAM
low complexity region 74 87 N/A INTRINSIC
FN3 193 290 6.54e-6 SMART
FN3 306 392 1.66e-7 SMART
Pfam:EphA2_TM 421 496 2.4e-15 PFAM
TyrKc 499 754 5.17e-90 SMART
SAM 784 851 1.2e-15 SMART
low complexity region 852 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors, the largest subfamily of receptor tyrosine kinases (RTKs), and their ephrin ligands are important mediators of cell-cell communication regulating cell attachment, shape, and mobility in neuronal and epithelial cells (Aasheim et al., 2005 [PubMed 15777695]). See MIM 179610 for additional background on Eph receptors and ephrins.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik A G 14: 44,170,442 S45P probably damaging Het
Adgrg4 C T X: 56,916,442 R1124C possibly damaging Het
Anxa13 T C 15: 58,356,203 noncoding transcript Het
Arhgap32 C A 9: 32,181,839 probably null Het
Carm1 T C 9: 21,569,526 F99L probably damaging Het
Dennd1b A G 1: 139,085,927 E253G possibly damaging Het
Dsg4 A G 18: 20,461,436 I541V probably benign Het
Dstyk A G 1: 132,434,389 T186A possibly damaging Het
Ear1 A T 14: 43,819,264 V49D probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fndc8 T A 11: 82,892,400 M69K probably benign Het
Gm13023 G C 4: 143,793,983 E102Q probably benign Het
Golga1 T C 2: 39,023,454 I482V probably benign Het
Hivep3 G A 4: 119,733,793 probably benign Het
Igkv13-85 A G 6: 68,930,372 F82L probably damaging Het
Itih1 G A 14: 30,935,885 R410C probably damaging Het
Kcnc2 T C 10: 112,455,794 W296R probably damaging Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Kif3b T C 2: 153,323,644 probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Notch1 A G 2: 26,472,177 V1022A probably benign Het
Npc1l1 A G 11: 6,228,741 L223S possibly damaging Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr279 T C 15: 98,498,134 F221L probably benign Het
Pbxip1 A G 3: 89,446,383 D281G possibly damaging Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Pcsk5 C T 19: 17,451,955 C1553Y probably damaging Het
Pdgfc A C 3: 81,174,991 M164L probably benign Het
Pdzd8 T C 19: 59,345,448 Y47C probably damaging Het
Pip5k1c T A 10: 81,315,111 I633N probably damaging Het
Pkn1 G A 8: 83,692,927 R16* probably null Het
Pole2 A G 12: 69,222,468 V85A probably benign Het
Ppp4c A C 7: 126,787,465 L150R probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Rnf144a T A 12: 26,327,303 R92S probably benign Het
Sbno2 C A 10: 80,060,492 R898L possibly damaging Het
Scnn1b A C 7: 121,912,475 N370T probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Vps13a T C 19: 16,695,502 E1302G possibly damaging Het
Other mutations in Epha10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01969:Epha10 APN 4 124885877 missense probably damaging 1.00
R1319:Epha10 UTSW 4 124881914 missense probably benign
R1544:Epha10 UTSW 4 124885596 missense probably damaging 1.00
R4505:Epha10 UTSW 4 124915687 unclassified probably benign
R4507:Epha10 UTSW 4 124915687 unclassified probably benign
R4572:Epha10 UTSW 4 124902568 missense unknown
R4605:Epha10 UTSW 4 124885757 missense probably damaging 1.00
R4818:Epha10 UTSW 4 124886214 critical splice donor site probably null
R5037:Epha10 UTSW 4 124915385 unclassified probably benign
R5281:Epha10 UTSW 4 124913988 unclassified probably benign
R5319:Epha10 UTSW 4 124914000 unclassified probably benign
R5322:Epha10 UTSW 4 124885748 missense probably damaging 1.00
R5400:Epha10 UTSW 4 124914121 unclassified probably benign
R5681:Epha10 UTSW 4 124902566 missense unknown
R5694:Epha10 UTSW 4 124902653 missense unknown
R6813:Epha10 UTSW 4 124902693 missense
R7471:Epha10 UTSW 4 124902572 missense
R7699:Epha10 UTSW 4 124902647 missense
R7732:Epha10 UTSW 4 124915299 missense
R7735:Epha10 UTSW 4 124913679 missense
R7793:Epha10 UTSW 4 124914453 missense probably benign 0.00
R7899:Epha10 UTSW 4 124914835 missense
R8057:Epha10 UTSW 4 124902683 missense
R8142:Epha10 UTSW 4 124885846 missense probably damaging 0.99
X0026:Epha10 UTSW 4 124885547 missense probably damaging 1.00
Z1176:Epha10 UTSW 4 124883942 missense probably damaging 1.00
Z1176:Epha10 UTSW 4 124885775 missense probably damaging 1.00
Z1177:Epha10 UTSW 4 124881960 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCCTTCCAACTTGGGAAAG -3'
(R):5'- GAACCTCGTTTTAGGACCACTAG -3'

Sequencing Primer
(F):5'- AAAGCCCCATCTGTCCTGG -3'
(R):5'- CCACTAGGTCAGCAAGGTGTTG -3'
Posted On2015-07-21