Incidental Mutation 'R4504:Gm13023'
ID331922
Institutional Source Beutler Lab
Gene Symbol Gm13023
Ensembl Gene ENSMUSG00000066031
Gene Namepredicted gene 13023
SynonymsMGC:91194
MMRRC Submission 041755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R4504 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location143789352-143795575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 143793983 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 102 (E102Q)
Ref Sequence ENSEMBL: ENSMUSP00000115387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085144] [ENSMUST00000105770] [ENSMUST00000149739]
Predicted Effect probably benign
Transcript: ENSMUST00000085144
AA Change: E266Q

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000082232
Gene: ENSMUSG00000066031
AA Change: E266Q

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 420 3e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139978
Predicted Effect probably benign
Transcript: ENSMUST00000149739
AA Change: E102Q

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik A G 14: 44,170,442 S45P probably damaging Het
Adgrg4 C T X: 56,916,442 R1124C possibly damaging Het
Anxa13 T C 15: 58,356,203 noncoding transcript Het
Arhgap32 C A 9: 32,181,839 probably null Het
Carm1 T C 9: 21,569,526 F99L probably damaging Het
Dennd1b A G 1: 139,085,927 E253G possibly damaging Het
Dsg4 A G 18: 20,461,436 I541V probably benign Het
Dstyk A G 1: 132,434,389 T186A possibly damaging Het
Ear1 A T 14: 43,819,264 V49D probably benign Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fndc8 T A 11: 82,892,400 M69K probably benign Het
Golga1 T C 2: 39,023,454 I482V probably benign Het
Hivep3 G A 4: 119,733,793 probably benign Het
Igkv13-85 A G 6: 68,930,372 F82L probably damaging Het
Itih1 G A 14: 30,935,885 R410C probably damaging Het
Kcnc2 T C 10: 112,455,794 W296R probably damaging Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Kif3b T C 2: 153,323,644 probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Notch1 A G 2: 26,472,177 V1022A probably benign Het
Npc1l1 A G 11: 6,228,741 L223S possibly damaging Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr279 T C 15: 98,498,134 F221L probably benign Het
Pbxip1 A G 3: 89,446,383 D281G possibly damaging Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Pcsk5 C T 19: 17,451,955 C1553Y probably damaging Het
Pdgfc A C 3: 81,174,991 M164L probably benign Het
Pdzd8 T C 19: 59,345,448 Y47C probably damaging Het
Pip5k1c T A 10: 81,315,111 I633N probably damaging Het
Pkn1 G A 8: 83,692,927 R16* probably null Het
Pole2 A G 12: 69,222,468 V85A probably benign Het
Ppp4c A C 7: 126,787,465 L150R probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Rnf144a T A 12: 26,327,303 R92S probably benign Het
Sbno2 C A 10: 80,060,492 R898L possibly damaging Het
Scnn1b A C 7: 121,912,475 N370T probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Vps13a T C 19: 16,695,502 E1302G possibly damaging Het
Other mutations in Gm13023
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Gm13023 APN 4 143795274 missense probably benign 0.43
IGL01621:Gm13023 APN 4 143793932 missense probably benign
IGL01777:Gm13023 APN 4 143795118 missense possibly damaging 0.87
IGL02075:Gm13023 APN 4 143795032 missense probably benign 0.05
IGL02098:Gm13023 APN 4 143793678 critical splice donor site probably null
IGL02148:Gm13023 APN 4 143792734 missense probably benign 0.25
IGL02355:Gm13023 APN 4 143793010 missense probably damaging 1.00
IGL02362:Gm13023 APN 4 143793010 missense probably damaging 1.00
IGL02828:Gm13023 APN 4 143795125 missense possibly damaging 0.95
IGL03102:Gm13023 APN 4 143793546 missense possibly damaging 0.84
IGL03234:Gm13023 APN 4 143794936 missense probably benign 0.33
BB004:Gm13023 UTSW 4 143792966 missense probably benign 0.29
BB014:Gm13023 UTSW 4 143792966 missense probably benign 0.29
K3955:Gm13023 UTSW 4 143795140 missense possibly damaging 0.79
R0054:Gm13023 UTSW 4 143795002 missense probably damaging 1.00
R0637:Gm13023 UTSW 4 143793909 missense probably benign 0.35
R1227:Gm13023 UTSW 4 143793564 missense probably benign 0.00
R1370:Gm13023 UTSW 4 143795304 missense possibly damaging 0.94
R1709:Gm13023 UTSW 4 143793546 missense possibly damaging 0.84
R1982:Gm13023 UTSW 4 143795150 missense probably benign 0.02
R2292:Gm13023 UTSW 4 143793876 missense probably benign 0.08
R3087:Gm13023 UTSW 4 143793846 missense probably benign 0.25
R4235:Gm13023 UTSW 4 143794774 missense probably damaging 0.97
R4454:Gm13023 UTSW 4 143792824 missense probably benign 0.00
R4937:Gm13023 UTSW 4 143793837 missense possibly damaging 0.46
R5041:Gm13023 UTSW 4 143793690 missense probably benign 0.01
R5379:Gm13023 UTSW 4 143794923 missense probably benign 0.00
R5399:Gm13023 UTSW 4 143795032 missense probably benign 0.00
R5445:Gm13023 UTSW 4 143795137 missense possibly damaging 0.50
R6059:Gm13023 UTSW 4 143793980 missense possibly damaging 0.80
R6885:Gm13023 UTSW 4 143793533 missense probably damaging 1.00
R7846:Gm13023 UTSW 4 143793993 missense probably benign 0.02
R7927:Gm13023 UTSW 4 143792966 missense probably benign 0.29
R8285:Gm13023 UTSW 4 143794066 missense probably benign 0.02
Z1177:Gm13023 UTSW 4 143794981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGCCTCAGTGATAGAAATCTTC -3'
(R):5'- GGCCAGATTATCAAGGACTCC -3'

Sequencing Primer
(F):5'- TCTTCAAAACTGTACACGCAGACTG -3'
(R):5'- GCCAGATTATCAAGGACTCCCTAGC -3'
Posted On2015-07-21