Incidental Mutation 'R4504:Lhx5'
ID331924
Institutional Source Beutler Lab
Gene Symbol Lhx5
Ensembl Gene ENSMUSG00000029595
Gene NameLIM homeobox protein 5
SynonymsLim2
MMRRC Submission 041755-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.652) question?
Stock #R4504 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120431699-120441223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 120440008 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 298 (H298N)
Ref Sequence ENSEMBL: ENSMUSP00000031591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031591]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031591
AA Change: H298N

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031591
Gene: ENSMUSG00000029595
AA Change: H298N

DomainStartEndE-ValueType
LIM 4 55 1.7e-17 SMART
LIM 63 118 3e-18 SMART
low complexity region 120 135 N/A INTRINSIC
low complexity region 140 153 N/A INTRINSIC
HOX 180 242 1.33e-22 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 370 384 N/A INTRINSIC
Meta Mutation Damage Score 0.0897 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to a large protein family, members of which carry the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein may function as a transcriptional regulator and be involved in the control of differentiation and development of the forebrain. In mice, this protein is essential for the regulation of precursor cell proliferation and the control of neuronal differentiation and migration during hippocampal development. This protein is involved in learning and motor functions in adult mice. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most mice homozygous for a null mutation display defective hippocampal development and die within a few days after birth. Postmitotic hippocampal cells are unable to differentiate properly and migrate to correct positions, resulting in structural anomalies of the Ammon's horn and the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik A G 14: 44,170,442 S45P probably damaging Het
Adgrg4 C T X: 56,916,442 R1124C possibly damaging Het
Anxa13 T C 15: 58,356,203 noncoding transcript Het
Arhgap32 C A 9: 32,181,839 probably null Het
Carm1 T C 9: 21,569,526 F99L probably damaging Het
Dennd1b A G 1: 139,085,927 E253G possibly damaging Het
Dsg4 A G 18: 20,461,436 I541V probably benign Het
Dstyk A G 1: 132,434,389 T186A possibly damaging Het
Ear1 A T 14: 43,819,264 V49D probably benign Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fndc8 T A 11: 82,892,400 M69K probably benign Het
Gm13023 G C 4: 143,793,983 E102Q probably benign Het
Golga1 T C 2: 39,023,454 I482V probably benign Het
Hivep3 G A 4: 119,733,793 probably benign Het
Igkv13-85 A G 6: 68,930,372 F82L probably damaging Het
Itih1 G A 14: 30,935,885 R410C probably damaging Het
Kcnc2 T C 10: 112,455,794 W296R probably damaging Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Kif3b T C 2: 153,323,644 probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Notch1 A G 2: 26,472,177 V1022A probably benign Het
Npc1l1 A G 11: 6,228,741 L223S possibly damaging Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr279 T C 15: 98,498,134 F221L probably benign Het
Pbxip1 A G 3: 89,446,383 D281G possibly damaging Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Pcsk5 C T 19: 17,451,955 C1553Y probably damaging Het
Pdgfc A C 3: 81,174,991 M164L probably benign Het
Pdzd8 T C 19: 59,345,448 Y47C probably damaging Het
Pip5k1c T A 10: 81,315,111 I633N probably damaging Het
Pkn1 G A 8: 83,692,927 R16* probably null Het
Pole2 A G 12: 69,222,468 V85A probably benign Het
Ppp4c A C 7: 126,787,465 L150R probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Rnf144a T A 12: 26,327,303 R92S probably benign Het
Sbno2 C A 10: 80,060,492 R898L possibly damaging Het
Scnn1b A C 7: 121,912,475 N370T probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Vps13a T C 19: 16,695,502 E1302G possibly damaging Het
Other mutations in Lhx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1793:Lhx5 UTSW 5 120434660 missense probably damaging 1.00
R2958:Lhx5 UTSW 5 120435477 missense probably benign 0.09
R3019:Lhx5 UTSW 5 120440005 missense probably benign 0.02
R4505:Lhx5 UTSW 5 120440008 missense possibly damaging 0.92
R4507:Lhx5 UTSW 5 120440008 missense possibly damaging 0.92
R4508:Lhx5 UTSW 5 120435434 missense probably damaging 0.99
R4671:Lhx5 UTSW 5 120439967 missense probably benign 0.01
R4769:Lhx5 UTSW 5 120436438 missense probably benign 0.22
R5547:Lhx5 UTSW 5 120434610 missense probably benign 0.32
R7122:Lhx5 UTSW 5 120436345 missense probably benign 0.35
R7439:Lhx5 UTSW 5 120440284 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTACTGACAGCCCTATCTGG -3'
(R):5'- AGGACTCTTGAGGCTTACCC -3'

Sequencing Primer
(F):5'- CCTATCTGGGCGCCCTG -3'
(R):5'- ATACGGCCGCTTCGTTGAG -3'
Posted On2015-07-21