Incidental Mutation 'R4504:Ric8a'
ID331928
Institutional Source Beutler Lab
Gene Symbol Ric8a
Ensembl Gene ENSMUSG00000025485
Gene NameRIC8 guanine nucleotide exchange factor A
Synonymssynembryn, RIC-8, Ric8
MMRRC Submission 041755-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4504 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140856957-140864372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140858516 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 223 (I223V)
Ref Sequence ENSEMBL: ENSMUSP00000026558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026557] [ENSMUST00000026558] [ENSMUST00000209320] [ENSMUST00000209690] [ENSMUST00000209766] [ENSMUST00000211624] [ENSMUST00000210710] [ENSMUST00000210708] [ENSMUST00000211527] [ENSMUST00000211590]
Predicted Effect probably benign
Transcript: ENSMUST00000026557
SMART Domains Protein: ENSMUSP00000026557
Gene: ENSMUSG00000025484

DomainStartEndE-ValueType
Pfam:SNARE 20 82 3.4e-13 PFAM
transmembrane domain 87 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026558
AA Change: I223V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000026558
Gene: ENSMUSG00000025485
AA Change: I223V

DomainStartEndE-ValueType
Pfam:Ric8 66 505 2.3e-125 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209318
Predicted Effect probably benign
Transcript: ENSMUST00000209320
Predicted Effect probably benign
Transcript: ENSMUST00000209690
Predicted Effect probably benign
Transcript: ENSMUST00000209766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210157
Predicted Effect probably benign
Transcript: ENSMUST00000211624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210195
Predicted Effect probably benign
Transcript: ENSMUST00000210710
Predicted Effect probably benign
Transcript: ENSMUST00000210708
Predicted Effect probably benign
Transcript: ENSMUST00000211527
Predicted Effect probably benign
Transcript: ENSMUST00000211590
Meta Mutation Damage Score 0.0662 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in lethality during gastrulation. Heterozygotes exhibit impaired spatial learning and increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik A G 14: 44,170,442 S45P probably damaging Het
Adgrg4 C T X: 56,916,442 R1124C possibly damaging Het
Anxa13 T C 15: 58,356,203 noncoding transcript Het
Arhgap32 C A 9: 32,181,839 probably null Het
Carm1 T C 9: 21,569,526 F99L probably damaging Het
Dennd1b A G 1: 139,085,927 E253G possibly damaging Het
Dsg4 A G 18: 20,461,436 I541V probably benign Het
Dstyk A G 1: 132,434,389 T186A possibly damaging Het
Ear1 A T 14: 43,819,264 V49D probably benign Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fndc8 T A 11: 82,892,400 M69K probably benign Het
Gm13023 G C 4: 143,793,983 E102Q probably benign Het
Golga1 T C 2: 39,023,454 I482V probably benign Het
Hivep3 G A 4: 119,733,793 probably benign Het
Igkv13-85 A G 6: 68,930,372 F82L probably damaging Het
Itih1 G A 14: 30,935,885 R410C probably damaging Het
Kcnc2 T C 10: 112,455,794 W296R probably damaging Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Kif3b T C 2: 153,323,644 probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Notch1 A G 2: 26,472,177 V1022A probably benign Het
Npc1l1 A G 11: 6,228,741 L223S possibly damaging Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr279 T C 15: 98,498,134 F221L probably benign Het
Pbxip1 A G 3: 89,446,383 D281G possibly damaging Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Pcsk5 C T 19: 17,451,955 C1553Y probably damaging Het
Pdgfc A C 3: 81,174,991 M164L probably benign Het
Pdzd8 T C 19: 59,345,448 Y47C probably damaging Het
Pip5k1c T A 10: 81,315,111 I633N probably damaging Het
Pkn1 G A 8: 83,692,927 R16* probably null Het
Pole2 A G 12: 69,222,468 V85A probably benign Het
Ppp4c A C 7: 126,787,465 L150R probably damaging Het
Rnf144a T A 12: 26,327,303 R92S probably benign Het
Sbno2 C A 10: 80,060,492 R898L possibly damaging Het
Scnn1b A C 7: 121,912,475 N370T probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Vps13a T C 19: 16,695,502 E1302G possibly damaging Het
Other mutations in Ric8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Ric8a APN 7 140862357 missense probably benign 0.00
R0277:Ric8a UTSW 7 140857900 unclassified probably benign
R0529:Ric8a UTSW 7 140860893 missense probably damaging 1.00
R0707:Ric8a UTSW 7 140857973 unclassified probably benign
R1272:Ric8a UTSW 7 140862376 missense probably benign 0.22
R1627:Ric8a UTSW 7 140858178 missense probably damaging 0.98
R1655:Ric8a UTSW 7 140860895 missense probably benign 0.01
R2281:Ric8a UTSW 7 140861938 missense probably benign 0.44
R2327:Ric8a UTSW 7 140859558 missense probably damaging 1.00
R3721:Ric8a UTSW 7 140861961 critical splice donor site probably null
R4287:Ric8a UTSW 7 140861422 missense probably damaging 1.00
R4505:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4506:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4507:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4552:Ric8a UTSW 7 140861337 missense probably damaging 1.00
R5500:Ric8a UTSW 7 140858315 missense probably benign 0.43
R6737:Ric8a UTSW 7 140858876 unclassified probably null
R8150:Ric8a UTSW 7 140861356 missense probably damaging 1.00
R8391:Ric8a UTSW 7 140858003 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCTCCTTTTCCTGCTAACAG -3'
(R):5'- CACTGTGGAGAATACCCACC -3'

Sequencing Primer
(F):5'- TAACAGCCCTTCGCACGG -3'
(R):5'- TGTGGAGAATACCCACCTGCAAC -3'
Posted On2015-07-21