Mutagenetix > Incidental Mutation

Incidental Mutation 'R4504:Sbno2'

331934

Institutional Source

Beutler Lab

Gene Symbol

Sbno2

Ensembl Gene

ENSMUSG00000035673

Gene Name

strawberry notch 2

Synonyms

Stno

MMRRC Submission

041755-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4504 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80056992-80105571 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 80060492 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 898 (R898L)

Ref Sequence

ENSEMBL: ENSMUSP00000151590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042771] [ENSMUST00000097227] [ENSMUST00000105372] [ENSMUST00000183037] [ENSMUST00000217972] [ENSMUST00000218630] [ENSMUST00000219260]

AlphaFold

Q7TNB8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042771
AA Change: R898L

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000041635
Gene: ENSMUSG00000035673
AA Change: R898L

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
low complexity region	177	189	N/A	INTRINSIC
Pfam:AAA_34	209	500	8.2e-135	PFAM
Pfam:ResIII	239	419	7.7e-8	PFAM
low complexity region	611	631	N/A	INTRINSIC
Pfam:Helicase_C_4	726	1004	7.5e-120	PFAM
low complexity region	1263	1283	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097227

SMART Domains

Protein: ENSMUSP00000094863
Gene: ENSMUSG00000075706

Domain	Start	End	E-Value	Type
low complexity region	2	55	N/A	INTRINSIC
Pfam:GSHPx	97	204	6e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105372

SMART Domains

Protein: ENSMUSP00000101011
Gene: ENSMUSG00000075706

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:GSHPx	41	148	1.3e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136081

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144698

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154095

Predicted Effect

probably benign
Transcript: ENSMUST00000183037

SMART Domains

Protein: ENSMUSP00000138186
Gene: ENSMUSG00000075706

Domain	Start	End	E-Value	Type
Pfam:GSHPx	1	108	3.6e-47	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217876

Predicted Effect

probably benign
Transcript: ENSMUST00000217972

Predicted Effect

probably benign
Transcript: ENSMUST00000218630
AA Change: R898L

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219260
AA Change: R898L

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)

Meta Mutation Damage Score

0.1790

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

100% (45/45)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired osteoclast fusion, impaired osteoblastogenesis, osteopetrosis, increased bone mass, and decreased body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503E14Rik	A	G	14: 44,170,442	S45P	probably damaging	Het
Adgrg4	C	T	X: 56,916,442	R1124C	possibly damaging	Het
Anxa13	T	C	15: 58,356,203		noncoding transcript	Het
Arhgap32	C	A	9: 32,181,839		probably null	Het
Carm1	T	C	9: 21,569,526	F99L	probably damaging	Het
Dennd1b	A	G	1: 139,085,927	E253G	possibly damaging	Het
Dsg4	A	G	18: 20,461,436	I541V	probably benign	Het
Dstyk	A	G	1: 132,434,389	T186A	possibly damaging	Het
Ear1	A	T	14: 43,819,264	V49D	probably benign	Het
Epha10	A	G	4: 124,915,687		probably benign	Het
Fbxo18	A	G	2: 11,749,017	V838A	possibly damaging	Het
Fndc8	T	A	11: 82,892,400	M69K	probably benign	Het
Gm13023	G	C	4: 143,793,983	E102Q	probably benign	Het
Golga1	T	C	2: 39,023,454	I482V	probably benign	Het
Hivep3	G	A	4: 119,733,793		probably benign	Het
Igkv13-85	A	G	6: 68,930,372	F82L	probably damaging	Het
Itih1	G	A	14: 30,935,885	R410C	probably damaging	Het
Kcnc2	T	C	10: 112,455,794	W296R	probably damaging	Het
Kcnq3	A	T	15: 65,995,342	Y817*	probably null	Het
Kif3b	T	C	2: 153,323,644		probably null	Het
Krtcap2	A	G	3: 89,246,256		probably benign	Het
Lhx5	C	A	5: 120,440,008	H298N	possibly damaging	Het
Notch1	A	G	2: 26,472,177	V1022A	probably benign	Het
Npc1l1	A	G	11: 6,228,741	L223S	possibly damaging	Het
Olfr1258	C	T	2: 89,930,351	P181S	possibly damaging	Het
Olfr160	C	T	9: 37,711,464	V272I	probably benign	Het
Olfr279	T	C	15: 98,498,134	F221L	probably benign	Het
Pbxip1	A	G	3: 89,446,383	D281G	possibly damaging	Het
Pcdhga8	G	C	18: 37,816,763	V411L	probably damaging	Het
Pcsk5	C	T	19: 17,451,955	C1553Y	probably damaging	Het
Pdgfc	A	C	3: 81,174,991	M164L	probably benign	Het
Pdzd8	T	C	19: 59,345,448	Y47C	probably damaging	Het
Pip5k1c	T	A	10: 81,315,111	I633N	probably damaging	Het
Pkn1	G	A	8: 83,692,927	R16*	probably null	Het
Pole2	A	G	12: 69,222,468	V85A	probably benign	Het
Ppp4c	A	C	7: 126,787,465	L150R	probably damaging	Het
Ric8a	A	G	7: 140,858,516	I223V	probably benign	Het
Rnf144a	T	A	12: 26,327,303	R92S	probably benign	Het
Scnn1b	A	C	7: 121,912,475	N370T	probably damaging	Het
Taar3	A	G	10: 23,949,573	I6V	possibly damaging	Het
Vps13a	T	C	19: 16,695,502	E1302G	possibly damaging	Het

Other mutations in Sbno2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Sbno2	APN	10	80064506	splice site	probably benign
IGL01773:Sbno2	APN	10	80057831	missense	probably damaging	1.00
IGL01869:Sbno2	APN	10	80060392	critical splice donor site	probably null
IGL01911:Sbno2	APN	10	80069624	nonsense	probably null
IGL02071:Sbno2	APN	10	80060641	missense	probably damaging	1.00
IGL02094:Sbno2	APN	10	80057645	missense	probably benign
IGL02220:Sbno2	APN	10	80072368	missense	probably benign	0.04
IGL02366:Sbno2	APN	10	80064202	missense	probably damaging	1.00
IGL02608:Sbno2	APN	10	80067402	splice site	probably null
IGL03007:Sbno2	APN	10	80058550	splice site	probably benign
IGL03083:Sbno2	APN	10	80057534	missense	probably damaging	0.98
IGL03393:Sbno2	APN	10	80066901	missense	probably damaging	1.00
Narcissus	UTSW	10	80062208	missense	probably damaging	1.00
psychopomp	UTSW	10	80060016	missense	probably damaging	0.99
Unsafe	UTSW	10	80060215	missense	probably damaging	1.00
R0034:Sbno2	UTSW	10	80058340	splice site	probably benign
R0126:Sbno2	UTSW	10	80068853	splice site	probably null
R0652:Sbno2	UTSW	10	80067294	missense	probably damaging	1.00
R0964:Sbno2	UTSW	10	80084259	missense	possibly damaging	0.75
R1571:Sbno2	UTSW	10	80060392	critical splice donor site	probably null
R1601:Sbno2	UTSW	10	80060492	missense	probably damaging	0.98
R1634:Sbno2	UTSW	10	80060634	missense	possibly damaging	0.73
R1733:Sbno2	UTSW	10	80058508	missense	possibly damaging	0.92
R1762:Sbno2	UTSW	10	80066606	missense	probably damaging	1.00
R1832:Sbno2	UTSW	10	80060605	nonsense	probably null
R1859:Sbno2	UTSW	10	80058639	nonsense	probably null
R2086:Sbno2	UTSW	10	80057856	missense	possibly damaging	0.89
R2136:Sbno2	UTSW	10	80062693	missense	probably damaging	1.00
R2360:Sbno2	UTSW	10	80058021	missense	possibly damaging	0.81
R4426:Sbno2	UTSW	10	80072358	missense	probably null	0.02
R4692:Sbno2	UTSW	10	80086327	missense	possibly damaging	0.90
R5044:Sbno2	UTSW	10	80062188	missense	probably benign	0.11
R5166:Sbno2	UTSW	10	80066928	nonsense	probably null
R5576:Sbno2	UTSW	10	80067337	missense	probably damaging	0.99
R5665:Sbno2	UTSW	10	80058453	missense	probably benign	0.00
R5709:Sbno2	UTSW	10	80086337	start codon destroyed	probably null	0.89
R5828:Sbno2	UTSW	10	80066590	missense	possibly damaging	0.84
R6192:Sbno2	UTSW	10	80060016	missense	probably damaging	0.99
R6971:Sbno2	UTSW	10	80060034	missense	possibly damaging	0.95
R7012:Sbno2	UTSW	10	80069518	intron	probably benign
R7082:Sbno2	UTSW	10	80060090	splice site	probably null
R7133:Sbno2	UTSW	10	80086312	missense	probably damaging	1.00
R7438:Sbno2	UTSW	10	80069575	missense	unknown
R7481:Sbno2	UTSW	10	80057499	missense	probably benign	0.11
R7746:Sbno2	UTSW	10	80058874	missense	probably damaging	0.99
R7964:Sbno2	UTSW	10	80068351	missense	probably damaging	1.00
R8055:Sbno2	UTSW	10	80069431	missense	possibly damaging	0.81
R8221:Sbno2	UTSW	10	80070011	missense	probably benign
R8329:Sbno2	UTSW	10	80064387	missense	probably damaging	1.00
R8725:Sbno2	UTSW	10	80075256	missense	probably benign	0.09
R8727:Sbno2	UTSW	10	80075256	missense	probably benign	0.09
R8840:Sbno2	UTSW	10	80057526	missense	probably damaging	0.97
R8932:Sbno2	UTSW	10	80062208	missense	probably damaging	1.00
R8954:Sbno2	UTSW	10	80057962	missense	probably damaging	1.00
R9003:Sbno2	UTSW	10	80060215	missense	probably damaging	1.00
R9034:Sbno2	UTSW	10	80062757	missense	probably damaging	1.00
X0026:Sbno2	UTSW	10	80057459	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- TGGGATCCTAGGGCACTTTG -3'
(R):5'- TTCTGGGGTATGCTAGAGCC -3'

Sequencing Primer
(F):5'- GCTCTCCCTAGAATTCCACCCAC -3'
(R):5'- GGTATGCTAGAGCCTGAATCAC -3'

Posted On

2015-07-21