Mutagenetix > Incidental Mutations

Incidental Mutation 'R4504:Sbno2'

331934

Institutional Source

Beutler Lab

Gene Symbol

Sbno2

Ensembl Gene

ENSMUSG00000035673

Gene Name

strawberry notch 2

Synonyms

Stno

MMRRC Submission

041755-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.280) question?

Stock #

R4504 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80056992-80105571 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 80060492 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 898 (R898L)

Ref Sequence

ENSEMBL: ENSMUSP00000151590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042771] [ENSMUST00000097227] [ENSMUST00000105372] [ENSMUST00000183037] [ENSMUST00000217972] [ENSMUST00000218630] [ENSMUST00000219260]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042771
AA Change: R898L

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000041635
Gene: ENSMUSG00000035673
AA Change: R898L

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
low complexity region	177	189	N/A	INTRINSIC
Pfam:AAA_34	209	500	8.2e-135	PFAM
Pfam:ResIII	239	419	7.7e-8	PFAM
low complexity region	611	631	N/A	INTRINSIC
Pfam:Helicase_C_4	726	1004	7.5e-120	PFAM
low complexity region	1263	1283	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097227

SMART Domains

Protein: ENSMUSP00000094863
Gene: ENSMUSG00000075706

Domain	Start	End	E-Value	Type
low complexity region	2	55	N/A	INTRINSIC
Pfam:GSHPx	97	204	6e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105372

SMART Domains

Protein: ENSMUSP00000101011
Gene: ENSMUSG00000075706

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:GSHPx	41	148	1.3e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136081

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144698

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154095

Predicted Effect

probably benign
Transcript: ENSMUST00000183037

SMART Domains

Protein: ENSMUSP00000138186
Gene: ENSMUSG00000075706

Domain	Start	End	E-Value	Type
Pfam:GSHPx	1	108	3.6e-47	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217876

Predicted Effect

probably benign
Transcript: ENSMUST00000217972

Predicted Effect

probably benign
Transcript: ENSMUST00000218630
AA Change: R898L

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219260
AA Change: R898L

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)

Meta Mutation Damage Score

0.1790

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

100% (45/45)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired osteoclast fusion, impaired osteoblastogenesis, osteopetrosis, increased bone mass, and decreased body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503E14Rik	A	G	14: 44,170,442	S45P	probably damaging	Het
Adgrg4	C	T	X: 56,916,442	R1124C	possibly damaging	Het
Anxa13	T	C	15: 58,356,203		noncoding transcript	Het
Arhgap32	C	A	9: 32,181,839		probably null	Het
Carm1	T	C	9: 21,569,526	F99L	probably damaging	Het
Dennd1b	A	G	1: 139,085,927	E253G	possibly damaging	Het
Dsg4	A	G	18: 20,461,436	I541V	probably benign	Het
Dstyk	A	G	1: 132,434,389	T186A	possibly damaging	Het
Ear1	A	T	14: 43,819,264	V49D	probably benign	Het
Epha10	A	G	4: 124,915,687		probably benign	Het
Fbxo18	A	G	2: 11,749,017	V838A	possibly damaging	Het
Fndc8	T	A	11: 82,892,400	M69K	probably benign	Het
Gm13023	G	C	4: 143,793,983	E102Q	probably benign	Het
Golga1	T	C	2: 39,023,454	I482V	probably benign	Het
Hivep3	G	A	4: 119,733,793		probably benign	Het
Igkv13-85	A	G	6: 68,930,372	F82L	probably damaging	Het
Itih1	G	A	14: 30,935,885	R410C	probably damaging	Het
Kcnc2	T	C	10: 112,455,794	W296R	probably damaging	Het
Kcnq3	A	T	15: 65,995,342	Y817*	probably null	Het
Kif3b	T	C	2: 153,323,644		probably null	Het
Krtcap2	A	G	3: 89,246,256		probably benign	Het
Lhx5	C	A	5: 120,440,008	H298N	possibly damaging	Het
Notch1	A	G	2: 26,472,177	V1022A	probably benign	Het
Npc1l1	A	G	11: 6,228,741	L223S	possibly damaging	Het
Olfr1258	C	T	2: 89,930,351	P181S	possibly damaging	Het
Olfr160	C	T	9: 37,711,464	V272I	probably benign	Het
Olfr279	T	C	15: 98,498,134	F221L	probably benign	Het
Pbxip1	A	G	3: 89,446,383	D281G	possibly damaging	Het
Pcdhga8	G	C	18: 37,816,763	V411L	probably damaging	Het
Pcsk5	C	T	19: 17,451,955	C1553Y	probably damaging	Het
Pdgfc	A	C	3: 81,174,991	M164L	probably benign	Het
Pdzd8	T	C	19: 59,345,448	Y47C	probably damaging	Het
Pip5k1c	T	A	10: 81,315,111	I633N	probably damaging	Het
Pkn1	G	A	8: 83,692,927	R16*	probably null	Het
Pole2	A	G	12: 69,222,468	V85A	probably benign	Het
Ppp4c	A	C	7: 126,787,465	L150R	probably damaging	Het
Ric8a	A	G	7: 140,858,516	I223V	probably benign	Het
Rnf144a	T	A	12: 26,327,303	R92S	probably benign	Het
Scnn1b	A	C	7: 121,912,475	N370T	probably damaging	Het
Taar3	A	G	10: 23,949,573	I6V	possibly damaging	Het
Vps13a	T	C	19: 16,695,502	E1302G	possibly damaging	Het

Other mutations in Sbno2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Sbno2	APN	10	80064506	splice site	probably benign
IGL01773:Sbno2	APN	10	80057831	missense	probably damaging	1.00
IGL01869:Sbno2	APN	10	80060392	critical splice donor site	probably null
IGL01911:Sbno2	APN	10	80069624	nonsense	probably null
IGL02071:Sbno2	APN	10	80060641	missense	probably damaging	1.00
IGL02094:Sbno2	APN	10	80057645	missense	probably benign
IGL02220:Sbno2	APN	10	80072368	missense	probably benign	0.04
IGL02366:Sbno2	APN	10	80064202	missense	probably damaging	1.00
IGL02608:Sbno2	APN	10	80067402	splice site	probably null
IGL03007:Sbno2	APN	10	80058550	splice site	probably benign
IGL03083:Sbno2	APN	10	80057534	missense	probably damaging	0.98
IGL03393:Sbno2	APN	10	80066901	missense	probably damaging	1.00
R0034:Sbno2	UTSW	10	80058340	splice site	probably benign
R0126:Sbno2	UTSW	10	80068853	splice site	probably null
R0652:Sbno2	UTSW	10	80067294	missense	probably damaging	1.00
R0964:Sbno2	UTSW	10	80084259	missense	possibly damaging	0.75
R1571:Sbno2	UTSW	10	80060392	critical splice donor site	probably null
R1601:Sbno2	UTSW	10	80060492	missense	probably damaging	0.98
R1634:Sbno2	UTSW	10	80060634	missense	possibly damaging	0.73
R1733:Sbno2	UTSW	10	80058508	missense	possibly damaging	0.92
R1762:Sbno2	UTSW	10	80066606	missense	probably damaging	1.00
R1832:Sbno2	UTSW	10	80060605	nonsense	probably null
R1859:Sbno2	UTSW	10	80058639	nonsense	probably null
R2086:Sbno2	UTSW	10	80057856	missense	possibly damaging	0.89
R2136:Sbno2	UTSW	10	80062693	missense	probably damaging	1.00
R2360:Sbno2	UTSW	10	80058021	missense	possibly damaging	0.81
R4426:Sbno2	UTSW	10	80072358	missense	probably null	0.02
R4692:Sbno2	UTSW	10	80086327	missense	possibly damaging	0.90
R5044:Sbno2	UTSW	10	80062188	missense	probably benign	0.11
R5166:Sbno2	UTSW	10	80066928	nonsense	probably null
R5576:Sbno2	UTSW	10	80067337	missense	probably damaging	0.99
R5665:Sbno2	UTSW	10	80058453	missense	probably benign	0.00
R5709:Sbno2	UTSW	10	80086337	start codon destroyed	probably null	0.89
R5828:Sbno2	UTSW	10	80066590	missense	possibly damaging	0.84
R6192:Sbno2	UTSW	10	80060016	missense	probably damaging	0.99
R6971:Sbno2	UTSW	10	80060034	missense	possibly damaging	0.95
R7012:Sbno2	UTSW	10	80069518	intron	probably benign
R7082:Sbno2	UTSW	10	80060090	splice site	probably null
R7133:Sbno2	UTSW	10	80086312	missense	probably damaging	1.00
R7438:Sbno2	UTSW	10	80069575	missense	unknown
R7481:Sbno2	UTSW	10	80057499	missense	probably benign	0.11
R7746:Sbno2	UTSW	10	80058874	missense	probably damaging	0.99
R7964:Sbno2	UTSW	10	80068351	missense	probably damaging	1.00
R8055:Sbno2	UTSW	10	80069431	missense	possibly damaging	0.81
R8221:Sbno2	UTSW	10	80070011	missense	probably benign
R8329:Sbno2	UTSW	10	80064387	missense	probably damaging	1.00
X0026:Sbno2	UTSW	10	80057459	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- TGGGATCCTAGGGCACTTTG -3'
(R):5'- TTCTGGGGTATGCTAGAGCC -3'

Sequencing Primer
(F):5'- GCTCTCCCTAGAATTCCACCCAC -3'
(R):5'- GGTATGCTAGAGCCTGAATCAC -3'

Posted On

2015-07-21