Incidental Mutation 'R4504:Kcnc2'
ID331936
Institutional Source Beutler Lab
Gene Symbol Kcnc2
Ensembl Gene ENSMUSG00000035681
Gene Namepotassium voltage gated channel, Shaw-related subfamily, member 2
SynonymsKv3.2, KShIIIA
MMRRC Submission 041755-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4504 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location112271121-112467024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112455794 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 296 (W296R)
Ref Sequence ENSEMBL: ENSMUSP00000151579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092175] [ENSMUST00000218445] [ENSMUST00000218827] [ENSMUST00000219301] [ENSMUST00000219607]
Predicted Effect probably damaging
Transcript: ENSMUST00000092175
AA Change: W296R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089814
Gene: ENSMUSG00000035681
AA Change: W296R

DomainStartEndE-ValueType
BTB 8 163 2.53e-17 SMART
Pfam:Ion_trans 232 488 1e-46 PFAM
Pfam:Ion_trans_2 388 481 5.8e-13 PFAM
low complexity region 552 568 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218445
Predicted Effect probably benign
Transcript: ENSMUST00000218827
Predicted Effect probably damaging
Transcript: ENSMUST00000219301
AA Change: W296R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000219607
Meta Mutation Damage Score 0.9080 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to one of these subfamilies, namely the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired fast spiking in cortical interneurons, distorted cortical rhythmic activity, enhanced susceptibility to seizures, increased anxiety in the open field, and abnormal sleep patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik A G 14: 44,170,442 S45P probably damaging Het
Adgrg4 C T X: 56,916,442 R1124C possibly damaging Het
Anxa13 T C 15: 58,356,203 noncoding transcript Het
Arhgap32 C A 9: 32,181,839 probably null Het
Carm1 T C 9: 21,569,526 F99L probably damaging Het
Dennd1b A G 1: 139,085,927 E253G possibly damaging Het
Dsg4 A G 18: 20,461,436 I541V probably benign Het
Dstyk A G 1: 132,434,389 T186A possibly damaging Het
Ear1 A T 14: 43,819,264 V49D probably benign Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fndc8 T A 11: 82,892,400 M69K probably benign Het
Gm13023 G C 4: 143,793,983 E102Q probably benign Het
Golga1 T C 2: 39,023,454 I482V probably benign Het
Hivep3 G A 4: 119,733,793 probably benign Het
Igkv13-85 A G 6: 68,930,372 F82L probably damaging Het
Itih1 G A 14: 30,935,885 R410C probably damaging Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Kif3b T C 2: 153,323,644 probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Notch1 A G 2: 26,472,177 V1022A probably benign Het
Npc1l1 A G 11: 6,228,741 L223S possibly damaging Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr279 T C 15: 98,498,134 F221L probably benign Het
Pbxip1 A G 3: 89,446,383 D281G possibly damaging Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Pcsk5 C T 19: 17,451,955 C1553Y probably damaging Het
Pdgfc A C 3: 81,174,991 M164L probably benign Het
Pdzd8 T C 19: 59,345,448 Y47C probably damaging Het
Pip5k1c T A 10: 81,315,111 I633N probably damaging Het
Pkn1 G A 8: 83,692,927 R16* probably null Het
Pole2 A G 12: 69,222,468 V85A probably benign Het
Ppp4c A C 7: 126,787,465 L150R probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Rnf144a T A 12: 26,327,303 R92S probably benign Het
Sbno2 C A 10: 80,060,492 R898L possibly damaging Het
Scnn1b A C 7: 121,912,475 N370T probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Vps13a T C 19: 16,695,502 E1302G possibly damaging Het
Other mutations in Kcnc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Kcnc2 APN 10 112461988 missense probably damaging 0.99
IGL00595:Kcnc2 APN 10 112461987 missense probably benign 0.04
IGL01646:Kcnc2 APN 10 112272406 critical splice donor site probably null
IGL01950:Kcnc2 APN 10 112462075 intron probably benign
IGL02036:Kcnc2 APN 10 112455926 missense possibly damaging 0.94
IGL02164:Kcnc2 APN 10 112455685 missense possibly damaging 0.92
IGL02447:Kcnc2 APN 10 112455946 missense probably damaging 1.00
IGL03087:Kcnc2 APN 10 112455747 missense probably benign 0.19
IGL03385:Kcnc2 APN 10 112455786 missense probably damaging 1.00
R0133:Kcnc2 UTSW 10 112458597 missense probably damaging 1.00
R1444:Kcnc2 UTSW 10 112455601 unclassified probably benign
R1474:Kcnc2 UTSW 10 112456400 missense probably damaging 1.00
R2221:Kcnc2 UTSW 10 112456526 missense probably damaging 1.00
R4714:Kcnc2 UTSW 10 112455828 missense possibly damaging 0.82
R4935:Kcnc2 UTSW 10 112272228 missense probably benign 0.00
R6168:Kcnc2 UTSW 10 112455756 missense probably benign 0.13
R6338:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6375:Kcnc2 UTSW 10 112463189 missense possibly damaging 0.92
R6511:Kcnc2 UTSW 10 112462067 intron probably benign
R6516:Kcnc2 UTSW 10 112462000 missense probably benign 0.00
R6556:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6609:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6610:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6612:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6837:Kcnc2 UTSW 10 112458502 missense probably damaging 0.96
R7151:Kcnc2 UTSW 10 112458509 missense possibly damaging 0.46
R7715:Kcnc2 UTSW 10 112271940 nonsense probably null
Z1177:Kcnc2 UTSW 10 112272306 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATACGAGATGATTCAGGTCACTC -3'
(R):5'- CTGAGAAAGCCGAGCACATC -3'

Sequencing Primer
(F):5'- AGATGATTCAGGTCACTCTGTGTTTC -3'
(R):5'- AAGCCGAGCACATCTTTGG -3'
Posted On2015-07-21