Incidental Mutation 'R4504:Pole2'
ID331939
Institutional Source Beutler Lab
Gene Symbol Pole2
Ensembl Gene ENSMUSG00000020974
Gene Namepolymerase (DNA directed), epsilon 2 (p59 subunit)
SynonymsDNA polymerase epsilon small subunit
MMRRC Submission 041755-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4504 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69201773-69228195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69222468 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 85 (V85A)
Ref Sequence ENSEMBL: ENSMUSP00000152262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021359] [ENSMUST00000221411]
Predicted Effect probably benign
Transcript: ENSMUST00000021359
AA Change: V85A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021359
Gene: ENSMUSG00000020974
AA Change: V85A

DomainStartEndE-ValueType
Pfam:Dpoe2NT 2 74 1.9e-32 PFAM
Pfam:DNA_pol_E_B 287 489 1.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221411
AA Change: V85A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0768 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA polymerase epsilon, which is involved in DNA repair and replication, is composed of a large catalytic subunit and a small accessory subunit. The protein encoded by this gene represents the small subunit (B). Defects in this gene have been linked to colorectal cancer and to combined immunodeficiency. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik A G 14: 44,170,442 S45P probably damaging Het
Adgrg4 C T X: 56,916,442 R1124C possibly damaging Het
Anxa13 T C 15: 58,356,203 noncoding transcript Het
Arhgap32 C A 9: 32,181,839 probably null Het
Carm1 T C 9: 21,569,526 F99L probably damaging Het
Dennd1b A G 1: 139,085,927 E253G possibly damaging Het
Dsg4 A G 18: 20,461,436 I541V probably benign Het
Dstyk A G 1: 132,434,389 T186A possibly damaging Het
Ear1 A T 14: 43,819,264 V49D probably benign Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fndc8 T A 11: 82,892,400 M69K probably benign Het
Gm13023 G C 4: 143,793,983 E102Q probably benign Het
Golga1 T C 2: 39,023,454 I482V probably benign Het
Hivep3 G A 4: 119,733,793 probably benign Het
Igkv13-85 A G 6: 68,930,372 F82L probably damaging Het
Itih1 G A 14: 30,935,885 R410C probably damaging Het
Kcnc2 T C 10: 112,455,794 W296R probably damaging Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Kif3b T C 2: 153,323,644 probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Notch1 A G 2: 26,472,177 V1022A probably benign Het
Npc1l1 A G 11: 6,228,741 L223S possibly damaging Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr279 T C 15: 98,498,134 F221L probably benign Het
Pbxip1 A G 3: 89,446,383 D281G possibly damaging Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Pcsk5 C T 19: 17,451,955 C1553Y probably damaging Het
Pdgfc A C 3: 81,174,991 M164L probably benign Het
Pdzd8 T C 19: 59,345,448 Y47C probably damaging Het
Pip5k1c T A 10: 81,315,111 I633N probably damaging Het
Pkn1 G A 8: 83,692,927 R16* probably null Het
Ppp4c A C 7: 126,787,465 L150R probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Rnf144a T A 12: 26,327,303 R92S probably benign Het
Sbno2 C A 10: 80,060,492 R898L possibly damaging Het
Scnn1b A C 7: 121,912,475 N370T probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Vps13a T C 19: 16,695,502 E1302G possibly damaging Het
Other mutations in Pole2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pole2 APN 12 69226445 splice site probably benign
IGL00940:Pole2 APN 12 69215360 missense probably damaging 1.00
IGL01593:Pole2 APN 12 69223099 splice site probably null
IGL01609:Pole2 APN 12 69207857 critical splice donor site probably null
IGL01717:Pole2 APN 12 69213849 missense probably damaging 1.00
IGL02168:Pole2 APN 12 69201886 unclassified probably benign
IGL02208:Pole2 APN 12 69223162 missense possibly damaging 0.91
IGL02966:Pole2 APN 12 69209875 missense probably damaging 1.00
PIT4504001:Pole2 UTSW 12 69209985 nonsense probably null
R0069:Pole2 UTSW 12 69209887 missense probably damaging 1.00
R0069:Pole2 UTSW 12 69209887 missense probably damaging 1.00
R0396:Pole2 UTSW 12 69222386 splice site probably benign
R0574:Pole2 UTSW 12 69211457 splice site probably benign
R0620:Pole2 UTSW 12 69209879 missense probably damaging 1.00
R0685:Pole2 UTSW 12 69211413 missense probably damaging 0.98
R0791:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1452:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1453:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1455:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1912:Pole2 UTSW 12 69209990 missense probably damaging 0.99
R2067:Pole2 UTSW 12 69228152 missense probably benign 0.01
R2929:Pole2 UTSW 12 69209938 missense probably benign 0.13
R3016:Pole2 UTSW 12 69222062 missense probably benign 0.14
R4765:Pole2 UTSW 12 69222052 missense possibly damaging 0.49
R4790:Pole2 UTSW 12 69226365 missense probably benign 0.00
R4896:Pole2 UTSW 12 69223150 missense probably damaging 0.97
R6998:Pole2 UTSW 12 69213906 missense possibly damaging 0.82
R7257:Pole2 UTSW 12 69202910 missense probably damaging 1.00
R7535:Pole2 UTSW 12 69222429 missense probably benign 0.10
R7841:Pole2 UTSW 12 69204258 missense probably damaging 1.00
R8437:Pole2 UTSW 12 69204187 nonsense probably null
R8506:Pole2 UTSW 12 69208960 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCAAATAAGGTTGGTGCAGC -3'
(R):5'- TCTGCCTTTCTAGTGCAGGG -3'

Sequencing Primer
(F):5'- CGGGACTCATATGGTAGCTAC -3'
(R):5'- AGGCACCATGACTCCTGG -3'
Posted On2015-07-21