Incidental Mutation 'R4504:Itih1'
ID331941
Institutional Source Beutler Lab
Gene Symbol Itih1
Ensembl Gene ENSMUSG00000006529
Gene Nameinter-alpha trypsin inhibitor, heavy chain 1
Synonymsinter-alpha (globulin) inhibitor, H1 polypeptide, Itih-1, Intin1
MMRRC Submission 041755-MU
Accession Numbers

Genbank: NM_008406.3; Ensembl: ENSMUST00000163118

Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4504 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location30929180-30943289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30935885 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 410 (R410C)
Ref Sequence ENSEMBL: ENSMUSP00000126449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006704] [ENSMUST00000163118]
Predicted Effect probably damaging
Transcript: ENSMUST00000006704
AA Change: R414C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006704
Gene: ENSMUSG00000006529
AA Change: R414C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VIT 34 167 6e-79 SMART
low complexity region 240 251 N/A INTRINSIC
VWA 291 472 2.1e-32 SMART
Blast:VWA 528 577 5e-21 BLAST
Pfam:ITI_HC_C 706 892 2.1e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163118
AA Change: R410C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126449
Gene: ENSMUSG00000006529
AA Change: R410C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VIT 34 163 2.44e-80 SMART
low complexity region 236 247 N/A INTRINSIC
VWA 287 468 3.43e-30 SMART
Blast:VWA 524 573 5e-21 BLAST
Pfam:ITI_HC_C 701 888 5.3e-81 PFAM
Meta Mutation Damage Score 0.1740 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: This gene encodes a heavy chain of inter-alpha trypsin inhibitor (IaI) family of plasma serine protease inhibitors. IaI proteins are protein-glycosaminoglycan-protein complexes comprised of two heavy chains and a light chain. The encoded protein covalently associates with the light chain via a chondroitin sulfate moiety. Intravenous administration of the encoded protein improved survival of mice after infection with Escherichia coli. This gene is located adjacent to two other IaI heavy chain genes. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing to generate mature protein. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik A G 14: 44,170,442 S45P probably damaging Het
Adgrg4 C T X: 56,916,442 R1124C possibly damaging Het
Anxa13 T C 15: 58,356,203 noncoding transcript Het
Arhgap32 C A 9: 32,181,839 probably null Het
Carm1 T C 9: 21,569,526 F99L probably damaging Het
Dennd1b A G 1: 139,085,927 E253G possibly damaging Het
Dsg4 A G 18: 20,461,436 I541V probably benign Het
Dstyk A G 1: 132,434,389 T186A possibly damaging Het
Ear1 A T 14: 43,819,264 V49D probably benign Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fndc8 T A 11: 82,892,400 M69K probably benign Het
Gm13023 G C 4: 143,793,983 E102Q probably benign Het
Golga1 T C 2: 39,023,454 I482V probably benign Het
Hivep3 G A 4: 119,733,793 probably benign Het
Igkv13-85 A G 6: 68,930,372 F82L probably damaging Het
Kcnc2 T C 10: 112,455,794 W296R probably damaging Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Kif3b T C 2: 153,323,644 probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Notch1 A G 2: 26,472,177 V1022A probably benign Het
Npc1l1 A G 11: 6,228,741 L223S possibly damaging Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr279 T C 15: 98,498,134 F221L probably benign Het
Pbxip1 A G 3: 89,446,383 D281G possibly damaging Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Pcsk5 C T 19: 17,451,955 C1553Y probably damaging Het
Pdgfc A C 3: 81,174,991 M164L probably benign Het
Pdzd8 T C 19: 59,345,448 Y47C probably damaging Het
Pip5k1c T A 10: 81,315,111 I633N probably damaging Het
Pkn1 G A 8: 83,692,927 R16* probably null Het
Pole2 A G 12: 69,222,468 V85A probably benign Het
Ppp4c A C 7: 126,787,465 L150R probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Rnf144a T A 12: 26,327,303 R92S probably benign Het
Sbno2 C A 10: 80,060,492 R898L possibly damaging Het
Scnn1b A C 7: 121,912,475 N370T probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Vps13a T C 19: 16,695,502 E1302G possibly damaging Het
Other mutations in Itih1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Itih1 APN 14 30929821 missense probably benign 0.26
IGL00227:Itih1 APN 14 30942889 splice site probably null
IGL00902:Itih1 APN 14 30932482 splice site probably benign
IGL02194:Itih1 APN 14 30930365 missense probably benign 0.01
IGL02221:Itih1 APN 14 30929587 missense probably damaging 1.00
IGL02292:Itih1 APN 14 30933355 splice site probably null
IGL02733:Itih1 APN 14 30936720 missense probably damaging 1.00
IGL02928:Itih1 APN 14 30937758 missense probably damaging 1.00
IGL03064:Itih1 APN 14 30941557 missense probably benign 0.09
1mM(1):Itih1 UTSW 14 30929850 missense probably damaging 1.00
R0092:Itih1 UTSW 14 30940863 splice site probably benign
R0647:Itih1 UTSW 14 30935863 missense probably damaging 1.00
R0662:Itih1 UTSW 14 30933360 missense possibly damaging 0.63
R0744:Itih1 UTSW 14 30941555 missense probably damaging 1.00
R0833:Itih1 UTSW 14 30941555 missense probably damaging 1.00
R1070:Itih1 UTSW 14 30942456 splice site probably benign
R1397:Itih1 UTSW 14 30929905 splice site probably benign
R1797:Itih1 UTSW 14 30929899 missense probably damaging 1.00
R1898:Itih1 UTSW 14 30932287 missense probably benign
R1964:Itih1 UTSW 14 30929623 missense probably damaging 1.00
R1967:Itih1 UTSW 14 30941984 missense possibly damaging 0.67
R2086:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R2155:Itih1 UTSW 14 30938071 missense probably damaging 1.00
R2156:Itih1 UTSW 14 30933475 missense possibly damaging 0.88
R2225:Itih1 UTSW 14 30929577 missense possibly damaging 0.88
R3836:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R3837:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R3839:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R4388:Itih1 UTSW 14 30941555 missense possibly damaging 0.93
R4618:Itih1 UTSW 14 30929831 missense probably benign 0.33
R4682:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R4856:Itih1 UTSW 14 30936701 critical splice donor site probably null
R4886:Itih1 UTSW 14 30936701 critical splice donor site probably null
R5169:Itih1 UTSW 14 30933446 nonsense probably null
R5773:Itih1 UTSW 14 30935399 missense possibly damaging 0.89
R5875:Itih1 UTSW 14 30929530 missense probably benign
R6048:Itih1 UTSW 14 30929823 missense possibly damaging 0.89
R6077:Itih1 UTSW 14 30929876 missense possibly damaging 0.75
R6175:Itih1 UTSW 14 30931195 missense probably damaging 1.00
R6228:Itih1 UTSW 14 30931260 missense probably benign 0.00
R6664:Itih1 UTSW 14 30933436 missense probably damaging 1.00
R6675:Itih1 UTSW 14 30929841 missense possibly damaging 0.50
R7059:Itih1 UTSW 14 30931309 missense possibly damaging 0.93
R7168:Itih1 UTSW 14 30934107 missense probably null 0.98
R7408:Itih1 UTSW 14 30943160 missense probably benign 0.00
R7458:Itih1 UTSW 14 30943266 start codon destroyed probably null
R7717:Itih1 UTSW 14 30931185 missense probably damaging 1.00
R8016:Itih1 UTSW 14 30935294 missense probably damaging 0.96
R8035:Itih1 UTSW 14 30942525 missense probably benign 0.25
R8111:Itih1 UTSW 14 30932268 missense probably damaging 0.99
R8131:Itih1 UTSW 14 30941564 missense probably damaging 1.00
R8171:Itih1 UTSW 14 30937090 missense possibly damaging 0.80
Z1177:Itih1 UTSW 14 30929572 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCCCTTGGCATATTGCTGATGG -3'
(R):5'- CCTTCAGTGAGCTGTTTCCAG -3'

Sequencing Primer
(F):5'- CATATTGCTGATGGTGAATGGGAG -3'
(R):5'- AGCTGTCACAGTTGCCC -3'
Posted On2015-07-21