Incidental Mutation 'R4504:Kcnq3'
ID331944
Institutional Source Beutler Lab
Gene Symbol Kcnq3
Ensembl Gene ENSMUSG00000056258
Gene Namepotassium voltage-gated channel, subfamily Q, member 3
Synonyms
MMRRC Submission 041755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R4504 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location65986387-66286642 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 65995342 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 817 (Y817*)
Ref Sequence ENSEMBL: ENSMUSP00000063380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070256]
Predicted Effect probably null
Transcript: ENSMUST00000070256
AA Change: Y817*
SMART Domains Protein: ENSMUSP00000063380
Gene: ENSMUSG00000056258
AA Change: Y817*

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
Pfam:Ion_trans 122 364 9.9e-31 PFAM
Pfam:Ion_trans_2 268 357 3.4e-14 PFAM
Pfam:KCNQ_channel 448 658 1.4e-89 PFAM
Pfam:KCNQC3-Ank-G_bd 771 867 3.8e-41 PFAM
Meta Mutation Damage Score 0.9708 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the regulation of neuronal excitability. The encoded protein forms an M-channel by associating with the products of the related KCNQ2 or KCNQ5 genes, which both encode integral membrane proteins. M-channel currents are inhibited by M1 muscarinic acetylcholine receptors and are activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 2 (BFNC2), also known as epilepsy, benign neonatal type 2 (EBN2). Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal apamin-insensitive afterhyperpolarization currents in granule cells, but not pyramidal cells, of the hippocampus. Mice homozygous for a knock-in allele exhibit spontaneous seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik A G 14: 44,170,442 S45P probably damaging Het
Adgrg4 C T X: 56,916,442 R1124C possibly damaging Het
Anxa13 T C 15: 58,356,203 noncoding transcript Het
Arhgap32 C A 9: 32,181,839 probably null Het
Carm1 T C 9: 21,569,526 F99L probably damaging Het
Dennd1b A G 1: 139,085,927 E253G possibly damaging Het
Dsg4 A G 18: 20,461,436 I541V probably benign Het
Dstyk A G 1: 132,434,389 T186A possibly damaging Het
Ear1 A T 14: 43,819,264 V49D probably benign Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fndc8 T A 11: 82,892,400 M69K probably benign Het
Gm13023 G C 4: 143,793,983 E102Q probably benign Het
Golga1 T C 2: 39,023,454 I482V probably benign Het
Hivep3 G A 4: 119,733,793 probably benign Het
Igkv13-85 A G 6: 68,930,372 F82L probably damaging Het
Itih1 G A 14: 30,935,885 R410C probably damaging Het
Kcnc2 T C 10: 112,455,794 W296R probably damaging Het
Kif3b T C 2: 153,323,644 probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Notch1 A G 2: 26,472,177 V1022A probably benign Het
Npc1l1 A G 11: 6,228,741 L223S possibly damaging Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr279 T C 15: 98,498,134 F221L probably benign Het
Pbxip1 A G 3: 89,446,383 D281G possibly damaging Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Pcsk5 C T 19: 17,451,955 C1553Y probably damaging Het
Pdgfc A C 3: 81,174,991 M164L probably benign Het
Pdzd8 T C 19: 59,345,448 Y47C probably damaging Het
Pip5k1c T A 10: 81,315,111 I633N probably damaging Het
Pkn1 G A 8: 83,692,927 R16* probably null Het
Pole2 A G 12: 69,222,468 V85A probably benign Het
Ppp4c A C 7: 126,787,465 L150R probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Rnf144a T A 12: 26,327,303 R92S probably benign Het
Sbno2 C A 10: 80,060,492 R898L possibly damaging Het
Scnn1b A C 7: 121,912,475 N370T probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Vps13a T C 19: 16,695,502 E1302G possibly damaging Het
Other mutations in Kcnq3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Kcnq3 APN 15 65995271 missense probably damaging 1.00
IGL00808:Kcnq3 APN 15 65995754 missense possibly damaging 0.49
IGL00969:Kcnq3 APN 15 66004726 missense probably damaging 1.00
IGL01121:Kcnq3 APN 15 66005977 splice site probably benign
IGL01996:Kcnq3 APN 15 66023696 missense probably damaging 0.98
IGL02153:Kcnq3 APN 15 66025191 missense probably damaging 0.96
IGL02950:Kcnq3 APN 15 66020293 missense probably benign 0.12
IGL02963:Kcnq3 APN 15 66285826 splice site probably benign
IGL03102:Kcnq3 APN 15 66028788 missense probably damaging 1.00
IGL03050:Kcnq3 UTSW 15 66025178 missense possibly damaging 0.52
R0345:Kcnq3 UTSW 15 66020305 missense possibly damaging 0.55
R0388:Kcnq3 UTSW 15 66000038 missense probably benign 0.00
R0730:Kcnq3 UTSW 15 65995608 missense probably benign
R1173:Kcnq3 UTSW 15 66000042 missense probably benign 0.01
R1610:Kcnq3 UTSW 15 66025260 missense probably damaging 1.00
R1678:Kcnq3 UTSW 15 66031432 missense probably damaging 1.00
R1714:Kcnq3 UTSW 15 66000063 missense probably benign 0.21
R1755:Kcnq3 UTSW 15 65995421 missense probably damaging 1.00
R1768:Kcnq3 UTSW 15 66005906 missense probably damaging 0.98
R1873:Kcnq3 UTSW 15 66002255 missense probably benign 0.16
R1925:Kcnq3 UTSW 15 66004809 missense possibly damaging 0.75
R1970:Kcnq3 UTSW 15 66028623 critical splice donor site probably null
R2140:Kcnq3 UTSW 15 66005978 splice site probably benign
R2141:Kcnq3 UTSW 15 65995851 missense probably benign 0.21
R2149:Kcnq3 UTSW 15 66023729 missense probably damaging 1.00
R2212:Kcnq3 UTSW 15 66020293 missense probably benign
R2272:Kcnq3 UTSW 15 66028680 missense probably damaging 1.00
R2566:Kcnq3 UTSW 15 66031427 missense probably damaging 1.00
R2909:Kcnq3 UTSW 15 66025236 missense possibly damaging 0.87
R3703:Kcnq3 UTSW 15 66021739 critical splice donor site probably null
R3704:Kcnq3 UTSW 15 66021739 critical splice donor site probably null
R3899:Kcnq3 UTSW 15 66030523 missense probably benign 0.01
R4096:Kcnq3 UTSW 15 66285815 splice site probably null
R4421:Kcnq3 UTSW 15 65995511 missense probably benign 0.01
R4505:Kcnq3 UTSW 15 65995342 nonsense probably null
R4571:Kcnq3 UTSW 15 66030612 missense probably damaging 1.00
R4577:Kcnq3 UTSW 15 66286214 missense unknown
R4900:Kcnq3 UTSW 15 65995410 missense probably damaging 1.00
R4981:Kcnq3 UTSW 15 66031405 missense possibly damaging 0.84
R5015:Kcnq3 UTSW 15 66004763 missense probably damaging 1.00
R5049:Kcnq3 UTSW 15 66285897 missense probably benign 0.17
R5245:Kcnq3 UTSW 15 66031435 missense possibly damaging 0.89
R5334:Kcnq3 UTSW 15 66025224 missense probably damaging 1.00
R5528:Kcnq3 UTSW 15 66025178 missense probably damaging 0.97
R5532:Kcnq3 UTSW 15 65997773 nonsense probably null
R5630:Kcnq3 UTSW 15 66025122 missense probably damaging 1.00
R5639:Kcnq3 UTSW 15 65997750 missense probably damaging 0.96
R5936:Kcnq3 UTSW 15 66000110 missense probably damaging 1.00
R6306:Kcnq3 UTSW 15 66004794 missense probably benign 0.40
R6576:Kcnq3 UTSW 15 66025178 missense possibly damaging 0.52
R7006:Kcnq3 UTSW 15 66020316 nonsense probably null
R7403:Kcnq3 UTSW 15 66002217 missense probably damaging 1.00
R8140:Kcnq3 UTSW 15 65995541 missense probably damaging 1.00
RF045:Kcnq3 UTSW 15 66286184 small deletion probably benign
X0060:Kcnq3 UTSW 15 66031386 missense probably damaging 1.00
Z1177:Kcnq3 UTSW 15 65995452 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GTGACCCCTTTTAAGTGGGC -3'
(R):5'- ATATGCAGAGAGGCCCACAG -3'

Sequencing Primer
(F):5'- ACCCCTTTTAAGTGGGCTTGTTG -3'
(R):5'- CATGTGTGAGCTACCACTCCCAG -3'
Posted On2015-07-21