Incidental Mutation 'R4505:Grb14'
ID331955
Institutional Source Beutler Lab
Gene Symbol Grb14
Ensembl Gene ENSMUSG00000026888
Gene Namegrowth factor receptor bound protein 14
Synonyms
Accession Numbers

Ncbi RefSeq: NM_016719.1; MGI:1355324

Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R4505 (G1)
Quality Score149
Status Validated
Chromosome2
Chromosomal Location64912476-65024987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65022568 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 26 (V26G)
Ref Sequence ENSEMBL: ENSMUSP00000028252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028252]
Predicted Effect probably damaging
Transcript: ENSMUST00000028252
AA Change: V26G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028252
Gene: ENSMUSG00000026888
AA Change: V26G

DomainStartEndE-ValueType
RA 104 190 2.88e-23 SMART
PH 233 342 1.91e-10 SMART
Pfam:BPS 367 415 1.5e-31 PFAM
SH2 435 524 5.34e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146807
Meta Mutation Damage Score 0.0906 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (50/52)
MGI Phenotype Strain: 3029164
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with insulin receptors and insulin-like growth-factor receptors. This protein likely has an inhibitory effect on receptor tyrosine kinase signaling and, in particular, on insulin receptor signaling. This gene may play a role in signaling pathways that regulate growth and metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous mutation of this gene results in improved glucose tolerance, lower circulating insulin levels and increased incorporation of glucose into glycogen in the liver and skeletal muscle of males. Both males and females exhibit a decrease in body size. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Acbd4 A G 11: 103,104,779 probably benign Het
Adarb2 A T 13: 8,697,691 S428C probably damaging Het
Atl3 T A 19: 7,520,819 D193E probably benign Het
Bhlhe22 T C 3: 18,054,959 S58P probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Epha10 A G 4: 124,915,687 probably benign Het
Farp2 A T 1: 93,619,010 N917I probably damaging Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fras1 T A 5: 96,781,348 N3870K probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr20 T C 15: 73,696,472 T23A probably benign Het
Itgb4 G A 11: 115,983,261 silent Het
Jak1 T C 4: 101,154,603 T1101A probably benign Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Lrig3 C T 10: 126,013,347 P979S probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Map4 T C 9: 110,032,185 S206P probably benign Het
Mon2 A G 10: 123,009,589 S1405P probably damaging Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr486 T C 7: 108,171,968 I259V probably benign Het
Pithd1 T C 4: 135,978,833 N37S probably benign Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Prb1 T A 6: 132,207,570 R367* probably null Het
Psmb4 A C 3: 94,886,145 Y142D probably damaging Het
Ptprs T C 17: 56,451,678 N181S possibly damaging Het
Rcbtb2 T C 14: 73,173,905 L370P probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Runx1t1 G T 4: 13,889,676 C535F probably damaging Het
Samd4b A G 7: 28,407,500 M329T probably benign Het
Serpinb9g T A 13: 33,486,563 F11L probably damaging Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Sp110 T G 1: 85,589,173 Q201P probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Tjp2 T C 19: 24,108,831 T776A possibly damaging Het
Tmc1 C T 19: 20,868,374 V162I probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Ush2a A G 1: 188,728,596 T2685A possibly damaging Het
Vmn2r102 C T 17: 19,660,583 T62I probably benign Het
Vps13c A T 9: 67,939,034 Q2128L probably benign Het
Zfp26 T C 9: 20,442,265 E76G probably benign Het
Zfp28 T C 7: 6,394,161 S532P probably damaging Het
Other mutations in Grb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Grb14 APN 2 64914718 missense probably damaging 1.00
IGL02267:Grb14 APN 2 64953616 missense probably damaging 1.00
IGL02902:Grb14 APN 2 64938418 missense probably damaging 1.00
R0066:Grb14 UTSW 2 64938492 critical splice acceptor site probably null
R0066:Grb14 UTSW 2 64938492 critical splice acceptor site probably null
R0658:Grb14 UTSW 2 64914727 nonsense probably null
R0681:Grb14 UTSW 2 64917287 missense probably damaging 1.00
R1215:Grb14 UTSW 2 64917264 missense probably benign 0.01
R1781:Grb14 UTSW 2 64975555 critical splice donor site probably null
R1932:Grb14 UTSW 2 64912802 missense probably damaging 1.00
R2034:Grb14 UTSW 2 64923529 splice site probably benign
R4405:Grb14 UTSW 2 64953622 missense probably damaging 1.00
R4580:Grb14 UTSW 2 64953603 missense probably benign 0.29
R5216:Grb14 UTSW 2 64917309 missense probably benign 0.00
R5367:Grb14 UTSW 2 64917309 missense probably benign 0.00
R5369:Grb14 UTSW 2 64917309 missense probably benign 0.00
R5382:Grb14 UTSW 2 64914734 missense probably damaging 1.00
R5457:Grb14 UTSW 2 64917098 missense probably damaging 1.00
R5816:Grb14 UTSW 2 64917284 missense probably damaging 1.00
R6062:Grb14 UTSW 2 65022620 missense possibly damaging 0.77
R7114:Grb14 UTSW 2 64916853 missense probably damaging 1.00
X0021:Grb14 UTSW 2 64936425 missense probably null 0.26
Predicted Primers PCR Primer
(F):5'- GTCTTCAGACACTTTCCAAACTTG -3'
(R):5'- TTCAGGAGAGTGACACCAGC -3'

Sequencing Primer
(F):5'- AAACTTGGTCCGGCTCTG -3'
(R):5'- GCTGGCGCTCCATCCTC -3'
Posted On2015-07-21