Incidental Mutation 'R4505:Cylc2'
ID331961
Institutional Source Beutler Lab
Gene Symbol Cylc2
Ensembl Gene ENSMUSG00000039555
Gene Namecylicin, basic protein of sperm head cytoskeleton 2
Synonyms4930488P18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4505 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location51216678-51230272 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 51229651 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 331 (T331R)
Ref Sequence ENSEMBL: ENSMUSP00000125758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041392] [ENSMUST00000166749]
Predicted Effect unknown
Transcript: ENSMUST00000041392
AA Change: T331R
SMART Domains Protein: ENSMUSP00000039750
Gene: ENSMUSG00000039555
AA Change: T331R

DomainStartEndE-ValueType
Pfam:Cylicin_N 7 115 1.1e-43 PFAM
low complexity region 122 131 N/A INTRINSIC
low complexity region 174 220 N/A INTRINSIC
low complexity region 224 245 N/A INTRINSIC
low complexity region 249 272 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156384
Predicted Effect unknown
Transcript: ENSMUST00000166749
AA Change: T331R
SMART Domains Protein: ENSMUSP00000125758
Gene: ENSMUSG00000039555
AA Change: T331R

DomainStartEndE-ValueType
Pfam:Cylicin_N 8 113 4.6e-46 PFAM
low complexity region 122 131 N/A INTRINSIC
low complexity region 174 220 N/A INTRINSIC
low complexity region 224 245 N/A INTRINSIC
low complexity region 249 272 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
low complexity region 338 420 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Acbd4 A G 11: 103,104,779 probably benign Het
Adarb2 A T 13: 8,697,691 S428C probably damaging Het
Atl3 T A 19: 7,520,819 D193E probably benign Het
Bhlhe22 T C 3: 18,054,959 S58P probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
Epha10 A G 4: 124,915,687 probably benign Het
Farp2 A T 1: 93,619,010 N917I probably damaging Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fras1 T A 5: 96,781,348 N3870K probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr20 T C 15: 73,696,472 T23A probably benign Het
Grb14 A C 2: 65,022,568 V26G probably damaging Het
Itgb4 G A 11: 115,983,261 silent Het
Jak1 T C 4: 101,154,603 T1101A probably benign Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Lrig3 C T 10: 126,013,347 P979S probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Map4 T C 9: 110,032,185 S206P probably benign Het
Mon2 A G 10: 123,009,589 S1405P probably damaging Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr486 T C 7: 108,171,968 I259V probably benign Het
Pithd1 T C 4: 135,978,833 N37S probably benign Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Prb1 T A 6: 132,207,570 R367* probably null Het
Psmb4 A C 3: 94,886,145 Y142D probably damaging Het
Ptprs T C 17: 56,451,678 N181S possibly damaging Het
Rcbtb2 T C 14: 73,173,905 L370P probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Runx1t1 G T 4: 13,889,676 C535F probably damaging Het
Samd4b A G 7: 28,407,500 M329T probably benign Het
Serpinb9g T A 13: 33,486,563 F11L probably damaging Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Sp110 T G 1: 85,589,173 Q201P probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Tjp2 T C 19: 24,108,831 T776A possibly damaging Het
Tmc1 C T 19: 20,868,374 V162I probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Ush2a A G 1: 188,728,596 T2685A possibly damaging Het
Vmn2r102 C T 17: 19,660,583 T62I probably benign Het
Vps13c A T 9: 67,939,034 Q2128L probably benign Het
Zfp26 T C 9: 20,442,265 E76G probably benign Het
Zfp28 T C 7: 6,394,161 S532P probably damaging Het
Other mutations in Cylc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Cylc2 APN 4 51228157 missense probably damaging 1.00
IGL01669:Cylc2 APN 4 51228360 missense probably benign 0.01
IGL02662:Cylc2 APN 4 51216698 utr 5 prime probably benign
R0277:Cylc2 UTSW 4 51228477 missense unknown
R0323:Cylc2 UTSW 4 51228477 missense unknown
R0968:Cylc2 UTSW 4 51216706 start codon destroyed probably null 0.50
R1395:Cylc2 UTSW 4 51228366 missense possibly damaging 0.53
R1639:Cylc2 UTSW 4 51228310 missense probably benign 0.23
R1643:Cylc2 UTSW 4 51225173 missense probably benign 0.38
R2829:Cylc2 UTSW 4 51229798 missense unknown
R4464:Cylc2 UTSW 4 51229651 missense unknown
R4467:Cylc2 UTSW 4 51229651 missense unknown
R4496:Cylc2 UTSW 4 51229651 missense unknown
R4514:Cylc2 UTSW 4 51229651 missense unknown
R4546:Cylc2 UTSW 4 51229651 missense unknown
R4546:Cylc2 UTSW 4 51229840 missense unknown
R4654:Cylc2 UTSW 4 51228279 missense probably benign 0.00
R4949:Cylc2 UTSW 4 51229804 missense unknown
R5141:Cylc2 UTSW 4 51228587 intron probably benign
R5176:Cylc2 UTSW 4 51228587 intron probably benign
R5177:Cylc2 UTSW 4 51228587 intron probably benign
R5179:Cylc2 UTSW 4 51228587 intron probably benign
R7469:Cylc2 UTSW 4 51227970 intron probably null
R7508:Cylc2 UTSW 4 51229256 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTCAGCCACAGAATCTGGAG -3'
(R):5'- GAACCAAGACCTACTTCTCCTACTTTG -3'

Sequencing Primer
(F):5'- ATCTGGAGGTGAAAAGGCTGGTTC -3'
(R):5'- AGACCTACTTCTCCTACTTTGCTTTC -3'
Posted On2015-07-21