Incidental Mutation 'R4505:Ric8a'
ID331973
Institutional Source Beutler Lab
Gene Symbol Ric8a
Ensembl Gene ENSMUSG00000025485
Gene NameRIC8 guanine nucleotide exchange factor A
Synonymssynembryn, RIC-8, Ric8
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4505 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140856957-140864372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140858516 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 223 (I223V)
Ref Sequence ENSEMBL: ENSMUSP00000026558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026557] [ENSMUST00000026558] [ENSMUST00000209320] [ENSMUST00000209690] [ENSMUST00000211624] [ENSMUST00000210710] [ENSMUST00000210708] [ENSMUST00000209766] [ENSMUST00000211527] [ENSMUST00000211590]
Predicted Effect probably benign
Transcript: ENSMUST00000026557
SMART Domains Protein: ENSMUSP00000026557
Gene: ENSMUSG00000025484

DomainStartEndE-ValueType
Pfam:SNARE 20 82 3.4e-13 PFAM
transmembrane domain 87 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026558
AA Change: I223V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000026558
Gene: ENSMUSG00000025485
AA Change: I223V

DomainStartEndE-ValueType
Pfam:Ric8 66 505 2.3e-125 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209318
Predicted Effect probably benign
Transcript: ENSMUST00000209320
Predicted Effect probably benign
Transcript: ENSMUST00000209690
Predicted Effect probably benign
Transcript: ENSMUST00000211624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210195
Predicted Effect probably benign
Transcript: ENSMUST00000210710
Predicted Effect probably benign
Transcript: ENSMUST00000210708
Predicted Effect probably benign
Transcript: ENSMUST00000209766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210157
Predicted Effect probably benign
Transcript: ENSMUST00000211527
Predicted Effect probably benign
Transcript: ENSMUST00000211590
Meta Mutation Damage Score 0.0662 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (50/52)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in lethality during gastrulation. Heterozygotes exhibit impaired spatial learning and increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Acbd4 A G 11: 103,104,779 probably benign Het
Adarb2 A T 13: 8,697,691 S428C probably damaging Het
Atl3 T A 19: 7,520,819 D193E probably benign Het
Bhlhe22 T C 3: 18,054,959 S58P probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Epha10 A G 4: 124,915,687 probably benign Het
Farp2 A T 1: 93,619,010 N917I probably damaging Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fras1 T A 5: 96,781,348 N3870K probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr20 T C 15: 73,696,472 T23A probably benign Het
Grb14 A C 2: 65,022,568 V26G probably damaging Het
Itgb4 G A 11: 115,983,261 silent Het
Jak1 T C 4: 101,154,603 T1101A probably benign Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Lrig3 C T 10: 126,013,347 P979S probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Map4 T C 9: 110,032,185 S206P probably benign Het
Mon2 A G 10: 123,009,589 S1405P probably damaging Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr486 T C 7: 108,171,968 I259V probably benign Het
Pithd1 T C 4: 135,978,833 N37S probably benign Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Prb1 T A 6: 132,207,570 R367* probably null Het
Psmb4 A C 3: 94,886,145 Y142D probably damaging Het
Ptprs T C 17: 56,451,678 N181S possibly damaging Het
Rcbtb2 T C 14: 73,173,905 L370P probably damaging Het
Runx1t1 G T 4: 13,889,676 C535F probably damaging Het
Samd4b A G 7: 28,407,500 M329T probably benign Het
Serpinb9g T A 13: 33,486,563 F11L probably damaging Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Sp110 T G 1: 85,589,173 Q201P probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Tjp2 T C 19: 24,108,831 T776A possibly damaging Het
Tmc1 C T 19: 20,868,374 V162I probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Ush2a A G 1: 188,728,596 T2685A possibly damaging Het
Vmn2r102 C T 17: 19,660,583 T62I probably benign Het
Vps13c A T 9: 67,939,034 Q2128L probably benign Het
Zfp26 T C 9: 20,442,265 E76G probably benign Het
Zfp28 T C 7: 6,394,161 S532P probably damaging Het
Other mutations in Ric8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Ric8a APN 7 140862357 missense probably benign 0.00
R0277:Ric8a UTSW 7 140857900 unclassified probably benign
R0529:Ric8a UTSW 7 140860893 missense probably damaging 1.00
R0707:Ric8a UTSW 7 140857973 unclassified probably benign
R1272:Ric8a UTSW 7 140862376 missense probably benign 0.22
R1627:Ric8a UTSW 7 140858178 missense probably damaging 0.98
R1655:Ric8a UTSW 7 140860895 missense probably benign 0.01
R2281:Ric8a UTSW 7 140861938 missense probably benign 0.44
R2327:Ric8a UTSW 7 140859558 missense probably damaging 1.00
R3721:Ric8a UTSW 7 140861961 critical splice donor site probably null
R4287:Ric8a UTSW 7 140861422 missense probably damaging 1.00
R4504:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4506:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4507:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4552:Ric8a UTSW 7 140861337 missense probably damaging 1.00
R5500:Ric8a UTSW 7 140858315 missense probably benign 0.43
R6737:Ric8a UTSW 7 140858876 splice site probably null
R8150:Ric8a UTSW 7 140861356 missense probably damaging 1.00
R8391:Ric8a UTSW 7 140858003 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGGCTCCTTTTCCTGCTAACAG -3'
(R):5'- TGTGGAGAATACCCACCTGC -3'

Sequencing Primer
(F):5'- TAACAGCCCTTCGCACGG -3'
(R):5'- AGGCACCTTCCCTGAGTTC -3'
Posted On2015-07-21