Incidental Mutation 'R4505:Piwil4'
ID331976
Institutional Source Beutler Lab
Gene Symbol Piwil4
Ensembl Gene ENSMUSG00000036912
Gene Namepiwi-like RNA-mediated gene silencing 4
SynonymsMiwi2, 9230101H05Rik, MIWI2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R4505 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location14696230-14740733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14725963 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 352 (T352A)
Ref Sequence ENSEMBL: ENSMUSP00000076213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076946] [ENSMUST00000115644]
Predicted Effect probably damaging
Transcript: ENSMUST00000076946
AA Change: T352A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076213
Gene: ENSMUSG00000036912
AA Change: T352A

DomainStartEndE-ValueType
Pfam:ArgoN 155 300 3.7e-11 PFAM
PAZ 313 450 2.55e-67 SMART
Piwi 614 864 8.98e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115644
AA Change: T305A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111308
Gene: ENSMUSG00000036912
AA Change: T305A

DomainStartEndE-ValueType
Pfam:ArgoN 92 245 6.5e-10 PFAM
PAZ 266 403 2.55e-67 SMART
Piwi 541 834 6.71e-126 SMART
Meta Mutation Damage Score 0.5736 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIWIL4 belongs to the Argonaute family of proteins, which function in development and maintenance of germline stem cells (Sasaki et al., 2003 [PubMed 12906857]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit male specific-infertility with a progressive loss of male germ cells, reduced testis size, abnormal male meiosis and increased apoptosis of spermatocytes in seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Acbd4 A G 11: 103,104,779 probably benign Het
Adarb2 A T 13: 8,697,691 S428C probably damaging Het
Atl3 T A 19: 7,520,819 D193E probably benign Het
Bhlhe22 T C 3: 18,054,959 S58P probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Epha10 A G 4: 124,915,687 probably benign Het
Farp2 A T 1: 93,619,010 N917I probably damaging Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fras1 T A 5: 96,781,348 N3870K probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr20 T C 15: 73,696,472 T23A probably benign Het
Grb14 A C 2: 65,022,568 V26G probably damaging Het
Itgb4 G A 11: 115,983,261 silent Het
Jak1 T C 4: 101,154,603 T1101A probably benign Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Lrig3 C T 10: 126,013,347 P979S probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Map4 T C 9: 110,032,185 S206P probably benign Het
Mon2 A G 10: 123,009,589 S1405P probably damaging Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr486 T C 7: 108,171,968 I259V probably benign Het
Pithd1 T C 4: 135,978,833 N37S probably benign Het
Prb1 T A 6: 132,207,570 R367* probably null Het
Psmb4 A C 3: 94,886,145 Y142D probably damaging Het
Ptprs T C 17: 56,451,678 N181S possibly damaging Het
Rcbtb2 T C 14: 73,173,905 L370P probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Runx1t1 G T 4: 13,889,676 C535F probably damaging Het
Samd4b A G 7: 28,407,500 M329T probably benign Het
Serpinb9g T A 13: 33,486,563 F11L probably damaging Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Sp110 T G 1: 85,589,173 Q201P probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Tjp2 T C 19: 24,108,831 T776A possibly damaging Het
Tmc1 C T 19: 20,868,374 V162I probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Ush2a A G 1: 188,728,596 T2685A possibly damaging Het
Vmn2r102 C T 17: 19,660,583 T62I probably benign Het
Vps13c A T 9: 67,939,034 Q2128L probably benign Het
Zfp26 T C 9: 20,442,265 E76G probably benign Het
Zfp28 T C 7: 6,394,161 S532P probably damaging Het
Other mutations in Piwil4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Piwil4 APN 9 14703097 missense probably damaging 1.00
IGL00331:Piwil4 APN 9 14715031 splice site probably benign
IGL00848:Piwil4 APN 9 14727411 missense probably damaging 0.98
IGL00920:Piwil4 APN 9 14727437 missense probably damaging 1.00
IGL01583:Piwil4 APN 9 14734487 missense probably damaging 1.00
IGL01690:Piwil4 APN 9 14703095 missense probably damaging 1.00
IGL01763:Piwil4 APN 9 14706266 unclassified probably null
IGL02103:Piwil4 APN 9 14725986 splice site probably null
IGL02898:Piwil4 APN 9 14706287 unclassified probably benign
IGL03037:Piwil4 APN 9 14705012 missense possibly damaging 0.88
IGL03352:Piwil4 APN 9 14725887 missense probably damaging 1.00
PIT4651001:Piwil4 UTSW 9 14708899 missense possibly damaging 0.48
R0453:Piwil4 UTSW 9 14727452 missense probably benign 0.00
R2324:Piwil4 UTSW 9 14736908 missense possibly damaging 0.88
R3236:Piwil4 UTSW 9 14700248 unclassified probably benign
R3408:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R3689:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R3844:Piwil4 UTSW 9 14729960 missense possibly damaging 0.54
R4191:Piwil4 UTSW 9 14715000 missense probably damaging 0.99
R4506:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R4541:Piwil4 UTSW 9 14718316 missense probably damaging 1.00
R4652:Piwil4 UTSW 9 14712308 nonsense probably null
R4876:Piwil4 UTSW 9 14740465 missense probably benign 0.22
R5027:Piwil4 UTSW 9 14709944 missense probably damaging 1.00
R5479:Piwil4 UTSW 9 14705041 missense probably damaging 1.00
R6656:Piwil4 UTSW 9 14709934 missense probably damaging 1.00
R6736:Piwil4 UTSW 9 14715823 missense probably benign
R7096:Piwil4 UTSW 9 14736816 nonsense probably null
R7124:Piwil4 UTSW 9 14736900 missense probably benign
R7358:Piwil4 UTSW 9 14729993 missense possibly damaging 0.82
R7371:Piwil4 UTSW 9 14727433 missense probably benign 0.08
R7419:Piwil4 UTSW 9 14702395 missense probably damaging 1.00
R7467:Piwil4 UTSW 9 14705041 missense probably damaging 1.00
R7571:Piwil4 UTSW 9 14734597 missense probably benign 0.08
R7644:Piwil4 UTSW 9 14734415 intron probably null
X0026:Piwil4 UTSW 9 14740591 utr 5 prime probably benign
X0064:Piwil4 UTSW 9 14708875 missense probably benign 0.00
Z1088:Piwil4 UTSW 9 14734517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTGTTGGAGAGGTCACAACC -3'
(R):5'- GTGTACTGAAGCGTTCACACTC -3'

Sequencing Primer
(F):5'- GGTCACAACCACAAGAAAAGTG -3'
(R):5'- CTCTGTTGAGAGCTGATCCTGC -3'
Posted On2015-07-21