Incidental Mutation 'R4505:Zfp26'
ID331977
Institutional Source Beutler Lab
Gene Symbol Zfp26
Ensembl Gene ENSMUSG00000063108
Gene Namezinc finger protein 26
SynonymsZfp70, KRAB15, Zfp81-rs1, Zfp-26, 5033428C05Rik, mkr-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4505 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20428449-20460162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20442265 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 76 (E76G)
Ref Sequence ENSEMBL: ENSMUSP00000124075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159569] [ENSMUST00000162438]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098970
Predicted Effect probably benign
Transcript: ENSMUST00000159569
AA Change: E76G

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124075
Gene: ENSMUSG00000063108
AA Change: E76G

DomainStartEndE-ValueType
Blast:KRAB 40 93 3e-6 BLAST
KRAB 107 167 4.28e-32 SMART
ZnF_C2H2 289 311 3.34e-2 SMART
ZnF_C2H2 344 366 3.63e-3 SMART
ZnF_C2H2 372 394 4.54e-4 SMART
ZnF_C2H2 400 422 2.65e-5 SMART
ZnF_C2H2 428 450 1.12e-3 SMART
ZnF_C2H2 456 478 9.08e-4 SMART
ZnF_C2H2 484 506 7.9e-4 SMART
ZnF_C2H2 512 534 2.43e-4 SMART
ZnF_C2H2 540 562 1.36e-2 SMART
ZnF_C2H2 568 590 3.44e-4 SMART
ZnF_C2H2 596 618 6.52e-5 SMART
ZnF_C2H2 624 646 2.32e-1 SMART
ZnF_C2H2 652 674 9.22e-5 SMART
ZnF_C2H2 680 702 1.22e-4 SMART
ZnF_C2H2 708 730 4.87e-4 SMART
ZnF_C2H2 736 758 4.54e-4 SMART
ZnF_C2H2 764 786 3.44e-4 SMART
ZnF_C2H2 792 814 5.21e-4 SMART
ZnF_C2H2 820 842 3.44e-4 SMART
ZnF_C2H2 848 870 5.14e-3 SMART
ZnF_C2H2 876 898 2.79e-4 SMART
ZnF_C2H2 904 926 2.12e-4 SMART
ZnF_C2H2 932 954 9.56e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161248
Predicted Effect probably benign
Transcript: ENSMUST00000162438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180846
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the krueppel C2H2-type zinc-finger protein family, and it contains one KRAB domain and eighteen C2H2-type zinc fingers. This gene is a candidate gene for autism and variable cognitive impairment in the 16q24.3 microdeletion syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Acbd4 A G 11: 103,104,779 probably benign Het
Adarb2 A T 13: 8,697,691 S428C probably damaging Het
Atl3 T A 19: 7,520,819 D193E probably benign Het
Bhlhe22 T C 3: 18,054,959 S58P probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Epha10 A G 4: 124,915,687 probably benign Het
Farp2 A T 1: 93,619,010 N917I probably damaging Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fras1 T A 5: 96,781,348 N3870K probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr20 T C 15: 73,696,472 T23A probably benign Het
Grb14 A C 2: 65,022,568 V26G probably damaging Het
Itgb4 G A 11: 115,983,261 silent Het
Jak1 T C 4: 101,154,603 T1101A probably benign Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Lrig3 C T 10: 126,013,347 P979S probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Map4 T C 9: 110,032,185 S206P probably benign Het
Mon2 A G 10: 123,009,589 S1405P probably damaging Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr486 T C 7: 108,171,968 I259V probably benign Het
Pithd1 T C 4: 135,978,833 N37S probably benign Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Prb1 T A 6: 132,207,570 R367* probably null Het
Psmb4 A C 3: 94,886,145 Y142D probably damaging Het
Ptprs T C 17: 56,451,678 N181S possibly damaging Het
Rcbtb2 T C 14: 73,173,905 L370P probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Runx1t1 G T 4: 13,889,676 C535F probably damaging Het
Samd4b A G 7: 28,407,500 M329T probably benign Het
Serpinb9g T A 13: 33,486,563 F11L probably damaging Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Sp110 T G 1: 85,589,173 Q201P probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Tjp2 T C 19: 24,108,831 T776A possibly damaging Het
Tmc1 C T 19: 20,868,374 V162I probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Ush2a A G 1: 188,728,596 T2685A possibly damaging Het
Vmn2r102 C T 17: 19,660,583 T62I probably benign Het
Vps13c A T 9: 67,939,034 Q2128L probably benign Het
Zfp28 T C 7: 6,394,161 S532P probably damaging Het
Other mutations in Zfp26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Zfp26 APN 9 20439548 missense possibly damaging 0.68
IGL02273:Zfp26 APN 9 20441448 missense probably damaging 0.96
FR4449:Zfp26 UTSW 9 20438546 missense probably benign 0.01
FR4548:Zfp26 UTSW 9 20438546 missense probably benign 0.01
FR4737:Zfp26 UTSW 9 20438546 missense probably benign 0.01
FR4976:Zfp26 UTSW 9 20438546 missense probably benign 0.01
LCD18:Zfp26 UTSW 9 20438546 missense probably benign 0.01
R0157:Zfp26 UTSW 9 20437870 missense probably benign 0.37
R1591:Zfp26 UTSW 9 20437625 missense probably benign 0.01
R1818:Zfp26 UTSW 9 20442191 missense probably benign 0.00
R1936:Zfp26 UTSW 9 20437553 missense probably benign 0.04
R2081:Zfp26 UTSW 9 20436617 missense probably benign 0.17
R2107:Zfp26 UTSW 9 20442237 missense probably benign
R2240:Zfp26 UTSW 9 20437267 missense probably damaging 1.00
R3429:Zfp26 UTSW 9 20441460 unclassified probably benign
R3785:Zfp26 UTSW 9 20437802 missense probably damaging 1.00
R4050:Zfp26 UTSW 9 20442229 missense probably benign
R4198:Zfp26 UTSW 9 20436716 missense probably benign 0.17
R4200:Zfp26 UTSW 9 20436716 missense probably benign 0.17
R4360:Zfp26 UTSW 9 20438573 missense probably benign 0.35
R5171:Zfp26 UTSW 9 20444907 missense probably benign
R5412:Zfp26 UTSW 9 20438239 missense possibly damaging 0.75
R5493:Zfp26 UTSW 9 20444319 missense possibly damaging 0.66
R5576:Zfp26 UTSW 9 20437507 missense possibly damaging 0.86
R5652:Zfp26 UTSW 9 20437841 nonsense probably null
R6089:Zfp26 UTSW 9 20437693 missense probably damaging 0.99
R6332:Zfp26 UTSW 9 20437286 missense probably damaging 1.00
R7599:Zfp26 UTSW 9 20437833 missense probably damaging 1.00
R7713:Zfp26 UTSW 9 20441334 missense probably benign 0.08
X0065:Zfp26 UTSW 9 20436891 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAACCCAGTTCTCTCCATGACTTC -3'
(R):5'- ACTCCTGTGTACTGGGATTGC -3'

Sequencing Primer
(F):5'- TGTCTCCATGAAGGTGTG -3'
(R):5'- GATTGCTGATGTTCTTACCATGC -3'
Posted On2015-07-21