Incidental Mutation 'R4505:Serpinb9g'
ID331986
Institutional Source Beutler Lab
Gene Symbol Serpinb9g
Ensembl Gene ENSMUSG00000057726
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9g
Synonyms1600002F03Rik, NK21B, ovalbumin
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R4505 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location33484790-33496004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33486563 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 11 (F11L)
Ref Sequence ENSEMBL: ENSMUSP00000080597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081927]
Predicted Effect probably damaging
Transcript: ENSMUST00000081927
AA Change: F11L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080597
Gene: ENSMUSG00000057726
AA Change: F11L

DomainStartEndE-ValueType
SERPIN 13 377 2.87e-166 SMART
Meta Mutation Damage Score 0.9174 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Acbd4 A G 11: 103,104,779 probably benign Het
Adarb2 A T 13: 8,697,691 S428C probably damaging Het
Atl3 T A 19: 7,520,819 D193E probably benign Het
Bhlhe22 T C 3: 18,054,959 S58P probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Epha10 A G 4: 124,915,687 probably benign Het
Farp2 A T 1: 93,619,010 N917I probably damaging Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fras1 T A 5: 96,781,348 N3870K probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr20 T C 15: 73,696,472 T23A probably benign Het
Grb14 A C 2: 65,022,568 V26G probably damaging Het
Itgb4 G A 11: 115,983,261 silent Het
Jak1 T C 4: 101,154,603 T1101A probably benign Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Lrig3 C T 10: 126,013,347 P979S probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Map4 T C 9: 110,032,185 S206P probably benign Het
Mon2 A G 10: 123,009,589 S1405P probably damaging Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr486 T C 7: 108,171,968 I259V probably benign Het
Pithd1 T C 4: 135,978,833 N37S probably benign Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Prb1 T A 6: 132,207,570 R367* probably null Het
Psmb4 A C 3: 94,886,145 Y142D probably damaging Het
Ptprs T C 17: 56,451,678 N181S possibly damaging Het
Rcbtb2 T C 14: 73,173,905 L370P probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Runx1t1 G T 4: 13,889,676 C535F probably damaging Het
Samd4b A G 7: 28,407,500 M329T probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Sp110 T G 1: 85,589,173 Q201P probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Tjp2 T C 19: 24,108,831 T776A possibly damaging Het
Tmc1 C T 19: 20,868,374 V162I probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Ush2a A G 1: 188,728,596 T2685A possibly damaging Het
Vmn2r102 C T 17: 19,660,583 T62I probably benign Het
Vps13c A T 9: 67,939,034 Q2128L probably benign Het
Zfp26 T C 9: 20,442,265 E76G probably benign Het
Zfp28 T C 7: 6,394,161 S532P probably damaging Het
Other mutations in Serpinb9g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Serpinb9g APN 13 33495105 nonsense probably null
IGL02346:Serpinb9g APN 13 33486531 start codon destroyed probably benign 0.12
IGL02665:Serpinb9g APN 13 33495103 missense possibly damaging 0.54
IGL02936:Serpinb9g APN 13 33494882 missense possibly damaging 0.94
R1611:Serpinb9g UTSW 13 33492874 missense possibly damaging 0.46
R3873:Serpinb9g UTSW 13 33486535 missense probably benign 0.45
R4060:Serpinb9g UTSW 13 33495106 missense probably benign 0.19
R6399:Serpinb9g UTSW 13 33492851 missense probably benign
R6843:Serpinb9g UTSW 13 33492917 missense probably damaging 1.00
R6844:Serpinb9g UTSW 13 33486633 missense probably damaging 0.99
R6942:Serpinb9g UTSW 13 33494905 missense probably benign 0.03
R7319:Serpinb9g UTSW 13 33488560 nonsense probably null
R7466:Serpinb9g UTSW 13 33495167 missense probably benign
R7470:Serpinb9g UTSW 13 33486634 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGTGTTCCTGCTATGATCAAC -3'
(R):5'- GCTCTTGTGCATGTGACAAGG -3'

Sequencing Primer
(F):5'- GTGTTCCTGCTATGATCAACTTACC -3'
(R):5'- GGTATGGTTTTACAGGGAACGTACC -3'
Posted On2015-07-21