Incidental Mutation 'R4505:Ptprs'
ID331995
Institutional Source Beutler Lab
Gene Symbol Ptprs
Ensembl Gene ENSMUSG00000013236
Gene Nameprotein tyrosine phosphatase, receptor type, S
SynonymsPtpt9, PTP-NU3, RPTPsigma, PTPsigma
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4505 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56412426-56476483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56451678 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 181 (N181S)
Ref Sequence ENSEMBL: ENSMUSP00000153134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067538] [ENSMUST00000086828] [ENSMUST00000223742] [ENSMUST00000223859]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067538
AA Change: N181S

PolyPhen 2 Score 0.567 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064048
Gene: ENSMUSG00000013236
AA Change: N181S

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
IGc2 45 114 3.38e-10 SMART
IGc2 147 214 2.4e-15 SMART
IGc2 244 305 8.26e-5 SMART
FN3 319 398 2.8e-14 SMART
FN3 414 497 3.24e-10 SMART
FN3 512 590 3.17e-13 SMART
FN3 605 692 9.69e-9 SMART
FN3 707 796 2.42e-9 SMART
FN3 811 890 2.22e0 SMART
FN3 905 995 8.31e-8 SMART
FN3 1009 1085 3.22e-5 SMART
low complexity region 1164 1177 N/A INTRINSIC
transmembrane domain 1259 1281 N/A INTRINSIC
PTPc 1351 1609 1.54e-136 SMART
PTPc 1638 1900 3.12e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000086828
AA Change: N181S

PolyPhen 2 Score 0.567 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084038
Gene: ENSMUSG00000013236
AA Change: N181S

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
IGc2 45 114 3.38e-10 SMART
IGc2 147 214 2.4e-15 SMART
IGc2 244 305 8.26e-5 SMART
FN3 319 398 2.8e-14 SMART
FN3 414 497 3.24e-10 SMART
FN3 512 590 3.17e-13 SMART
FN3 603 679 2.54e-3 SMART
low complexity region 758 771 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
PTPc 945 1203 1.54e-136 SMART
PTPc 1232 1494 3.12e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143018
Predicted Effect probably benign
Transcript: ENSMUST00000223742
Predicted Effect possibly damaging
Transcript: ENSMUST00000223859
AA Change: N181S

PolyPhen 2 Score 0.567 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225381
Meta Mutation Damage Score 0.1019 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Almost half of null homozygotes die in the first day of life. Embryos are characterized by decreased brain size including small pituitary glands and small olfactory bulbs. Adult mice are small, lack estrus, have decreased litter sizes and have impairedolfaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Acbd4 A G 11: 103,104,779 probably benign Het
Adarb2 A T 13: 8,697,691 S428C probably damaging Het
Atl3 T A 19: 7,520,819 D193E probably benign Het
Bhlhe22 T C 3: 18,054,959 S58P probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Epha10 A G 4: 124,915,687 probably benign Het
Farp2 A T 1: 93,619,010 N917I probably damaging Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fras1 T A 5: 96,781,348 N3870K probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr20 T C 15: 73,696,472 T23A probably benign Het
Grb14 A C 2: 65,022,568 V26G probably damaging Het
Itgb4 G A 11: 115,983,261 silent Het
Jak1 T C 4: 101,154,603 T1101A probably benign Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Lrig3 C T 10: 126,013,347 P979S probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Map4 T C 9: 110,032,185 S206P probably benign Het
Mon2 A G 10: 123,009,589 S1405P probably damaging Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr486 T C 7: 108,171,968 I259V probably benign Het
Pithd1 T C 4: 135,978,833 N37S probably benign Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Prb1 T A 6: 132,207,570 R367* probably null Het
Psmb4 A C 3: 94,886,145 Y142D probably damaging Het
Rcbtb2 T C 14: 73,173,905 L370P probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Runx1t1 G T 4: 13,889,676 C535F probably damaging Het
Samd4b A G 7: 28,407,500 M329T probably benign Het
Serpinb9g T A 13: 33,486,563 F11L probably damaging Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Sp110 T G 1: 85,589,173 Q201P probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Tjp2 T C 19: 24,108,831 T776A possibly damaging Het
Tmc1 C T 19: 20,868,374 V162I probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Ush2a A G 1: 188,728,596 T2685A possibly damaging Het
Vmn2r102 C T 17: 19,660,583 T62I probably benign Het
Vps13c A T 9: 67,939,034 Q2128L probably benign Het
Zfp26 T C 9: 20,442,265 E76G probably benign Het
Zfp28 T C 7: 6,394,161 S532P probably damaging Het
Other mutations in Ptprs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Ptprs APN 17 56458243 missense probably damaging 0.99
IGL01388:Ptprs APN 17 56421261 missense probably damaging 1.00
IGL01568:Ptprs APN 17 56413958 missense probably damaging 1.00
IGL01781:Ptprs APN 17 56435676 missense probably damaging 1.00
IGL02499:Ptprs APN 17 56437884 missense probably damaging 1.00
IGL02576:Ptprs APN 17 56414958 missense probably damaging 1.00
IGL02736:Ptprs APN 17 56458248 missense possibly damaging 0.88
IGL02871:Ptprs APN 17 56447443 missense probably damaging 1.00
IGL02946:Ptprs APN 17 56424032 missense probably benign
IGL03061:Ptprs APN 17 56418830 missense probably damaging 0.96
IGL03347:Ptprs APN 17 56435972 missense probably benign 0.07
IGL03351:Ptprs APN 17 56437943 missense probably damaging 1.00
P0019:Ptprs UTSW 17 56447474 splice site probably benign
PIT4434001:Ptprs UTSW 17 56454984 missense probably null 0.02
PIT4520001:Ptprs UTSW 17 56414980 missense probably damaging 1.00
R0240:Ptprs UTSW 17 56436087 unclassified probably null
R0240:Ptprs UTSW 17 56436087 unclassified probably null
R0504:Ptprs UTSW 17 56454220 missense possibly damaging 0.60
R0518:Ptprs UTSW 17 56419621 critical splice donor site probably null
R0539:Ptprs UTSW 17 56458255 missense probably damaging 0.97
R0620:Ptprs UTSW 17 56429103 missense possibly damaging 0.93
R0683:Ptprs UTSW 17 56414086 missense probably damaging 1.00
R1147:Ptprs UTSW 17 56423504 missense probably damaging 1.00
R1147:Ptprs UTSW 17 56423504 missense probably damaging 1.00
R1474:Ptprs UTSW 17 56424128 missense probably damaging 0.98
R1502:Ptprs UTSW 17 56437992 missense probably benign 0.00
R1817:Ptprs UTSW 17 56419527 missense probably damaging 1.00
R1844:Ptprs UTSW 17 56434510 missense probably damaging 1.00
R2077:Ptprs UTSW 17 56434990 missense probably null 0.26
R2086:Ptprs UTSW 17 56454984 missense probably null 0.02
R2149:Ptprs UTSW 17 56417706 missense probably damaging 1.00
R3618:Ptprs UTSW 17 56428965 missense probably benign 0.25
R3722:Ptprs UTSW 17 56417485 missense probably damaging 1.00
R3771:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R3772:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R3773:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R4032:Ptprs UTSW 17 56413386 missense probably damaging 1.00
R4326:Ptprs UTSW 17 56447468 missense possibly damaging 0.83
R4327:Ptprs UTSW 17 56447468 missense possibly damaging 0.83
R4480:Ptprs UTSW 17 56426404 missense possibly damaging 0.79
R4507:Ptprs UTSW 17 56419014 missense probably damaging 1.00
R4588:Ptprs UTSW 17 56425534 missense probably damaging 1.00
R4662:Ptprs UTSW 17 56417666 missense probably damaging 1.00
R4708:Ptprs UTSW 17 56428067 missense probably damaging 1.00
R5016:Ptprs UTSW 17 56419070 missense probably damaging 1.00
R5416:Ptprs UTSW 17 56435724 missense probably damaging 1.00
R5447:Ptprs UTSW 17 56429128 missense possibly damaging 0.50
R6041:Ptprs UTSW 17 56419080 missense probably benign 0.00
R6329:Ptprs UTSW 17 56417427 nonsense probably null
R6377:Ptprs UTSW 17 56418935 missense probably damaging 1.00
R6605:Ptprs UTSW 17 56422195 missense probably damaging 1.00
R6749:Ptprs UTSW 17 56437884 missense probably damaging 1.00
R7113:Ptprs UTSW 17 56451697 missense probably benign 0.40
R7114:Ptprs UTSW 17 56451697 missense probably benign 0.40
R7133:Ptprs UTSW 17 56417429 missense probably damaging 1.00
R7220:Ptprs UTSW 17 56418988 missense probably benign 0.29
R7423:Ptprs UTSW 17 56414793 missense probably damaging 1.00
R7440:Ptprs UTSW 17 56424256 missense possibly damaging 0.75
R7457:Ptprs UTSW 17 56419502 missense probably damaging 0.99
R7574:Ptprs UTSW 17 56423538 missense probably benign 0.00
RF014:Ptprs UTSW 17 56416935 missense probably damaging 1.00
X0028:Ptprs UTSW 17 56437831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCTCTCTACGTTTTGGG -3'
(R):5'- AGTCACTGAGGGCATTTGC -3'

Sequencing Primer
(F):5'- AGCTCTCTACGTTTTGGGTGCAG -3'
(R):5'- GCATTTGCCGCAATAACTGG -3'
Posted On2015-07-21