Mutagenetix > Incidental Mutations

Incidental Mutation 'R4505:Tmc1'

331997

Institutional Source

Beutler Lab

Gene Symbol

Tmc1

Ensembl Gene

ENSMUSG00000024749

Gene Name

transmembrane channel-like gene family 1

Synonyms

4933416G09Rik, Beethoven, Bth

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R4505 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20783458-20954202 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20868374 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 162 (V162I)

Ref Sequence

ENSEMBL: ENSMUSP00000040859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039500]

AlphaFold

Q8R4P5

Predicted Effect

probably benign
Transcript: ENSMUST00000039500
AA Change: V162I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: V162I

Domain	Start	End	E-Value	Type
SCOP:d1eq1a_	2	95	3e-3	SMART
low complexity region	129	150	N/A	INTRINSIC
transmembrane domain	184	206	N/A	INTRINSIC
transmembrane domain	265	287	N/A	INTRINSIC
low complexity region	295	302	N/A	INTRINSIC
transmembrane domain	357	379	N/A	INTRINSIC
transmembrane domain	431	453	N/A	INTRINSIC
Pfam:TMC	512	627	2.6e-36	PFAM
transmembrane domain	632	654	N/A	INTRINSIC
transmembrane domain	693	715	N/A	INTRINSIC
low complexity region	738	754	N/A	INTRINSIC

Meta Mutation Damage Score

0.0820

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	A	T	16: 20,333,695	I1367N	probably damaging	Het
Acbd4	A	G	11: 103,104,779		probably benign	Het
Adarb2	A	T	13: 8,697,691	S428C	probably damaging	Het
Atl3	T	A	19: 7,520,819	D193E	probably benign	Het
Bhlhe22	T	C	3: 18,054,959	S58P	probably benign	Het
Clasrp	C	A	7: 19,585,240		probably benign	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Epha10	A	G	4: 124,915,687		probably benign	Het
Farp2	A	T	1: 93,619,010	N917I	probably damaging	Het
Fbxo18	A	G	2: 11,749,017	V838A	possibly damaging	Het
Fras1	T	A	5: 96,781,348	N3870K	probably damaging	Het
Gm6632	C	T	5: 59,054,478		noncoding transcript	Het
Gm8909	A	T	17: 36,161,480		probably benign	Het
Gpr20	T	C	15: 73,696,472	T23A	probably benign	Het
Grb14	A	C	2: 65,022,568	V26G	probably damaging	Het
Itgb4	G	A	11: 115,983,261		silent	Het
Jak1	T	C	4: 101,154,603	T1101A	probably benign	Het
Kcnq3	A	T	15: 65,995,342	Y817*	probably null	Het
Krtcap2	A	G	3: 89,246,256		probably benign	Het
Lhx5	C	A	5: 120,440,008	H298N	possibly damaging	Het
Lrig3	C	T	10: 126,013,347	P979S	probably benign	Het
Map3k13	A	G	16: 21,922,178	S752G	probably benign	Het
Map4	T	C	9: 110,032,185	S206P	probably benign	Het
Mon2	A	G	10: 123,009,589	S1405P	probably damaging	Het
Mvb12a	G	T	8: 71,543,459	A86S	probably benign	Het
Olfr160	C	T	9: 37,711,464	V272I	probably benign	Het
Olfr486	T	C	7: 108,171,968	I259V	probably benign	Het
Pithd1	T	C	4: 135,978,833	N37S	probably benign	Het
Piwil4	T	C	9: 14,725,963	T352A	probably damaging	Het
Prb1	T	A	6: 132,207,570	R367*	probably null	Het
Psmb4	A	C	3: 94,886,145	Y142D	probably damaging	Het
Ptprs	T	C	17: 56,451,678	N181S	possibly damaging	Het
Rcbtb2	T	C	14: 73,173,905	L370P	probably damaging	Het
Ric8a	A	G	7: 140,858,516	I223V	probably benign	Het
Runx1t1	G	T	4: 13,889,676	C535F	probably damaging	Het
Samd4b	A	G	7: 28,407,500	M329T	probably benign	Het
Serpinb9g	T	A	13: 33,486,563	F11L	probably damaging	Het
Slc25a51	C	T	4: 45,399,768	V141M	probably benign	Het
Sp110	T	G	1: 85,589,173	Q201P	probably damaging	Het
Taar3	A	G	10: 23,949,573	I6V	possibly damaging	Het
Tjp2	T	C	19: 24,108,831	T776A	possibly damaging	Het
Upf1	G	A	8: 70,337,566	R637C	probably damaging	Het
Ush2a	A	G	1: 188,728,596	T2685A	possibly damaging	Het
Vmn2r102	C	T	17: 19,660,583	T62I	probably benign	Het
Vps13c	A	T	9: 67,939,034	Q2128L	probably benign	Het
Zfp26	T	C	9: 20,442,265	E76G	probably benign	Het
Zfp28	T	C	7: 6,394,161	S532P	probably damaging	Het

Other mutations in Tmc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01639:Tmc1	APN	19	20816192	missense	probably damaging	1.00
IGL02104:Tmc1	APN	19	20832454	missense	probably benign	0.00
IGL02245:Tmc1	APN	19	20799192	missense	probably damaging	1.00
IGL02544:Tmc1	APN	19	20906963	missense	probably benign	0.04
IGL02699:Tmc1	APN	19	20832350	critical splice donor site	probably null
IGL02974:Tmc1	APN	19	20900844	missense	probably benign
IGL03194:Tmc1	APN	19	20804653	missense	probably damaging	1.00
dinner_bell	UTSW	19	20795516	missense	probably damaging	0.99
R0255:Tmc1	UTSW	19	20789587	missense	possibly damaging	0.93
R0381:Tmc1	UTSW	19	20799045	missense	probably damaging	1.00
R0655:Tmc1	UTSW	19	20799176	missense	probably damaging	1.00
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1496:Tmc1	UTSW	19	20868355	missense	probably damaging	1.00
R1542:Tmc1	UTSW	19	20816122	missense	probably damaging	1.00
R1773:Tmc1	UTSW	19	20826501	splice site	probably null
R1777:Tmc1	UTSW	19	20816109	critical splice donor site	probably null
R2067:Tmc1	UTSW	19	20824309	missense	possibly damaging	0.90
R2152:Tmc1	UTSW	19	20856675	missense	probably benign	0.01
R2180:Tmc1	UTSW	19	20824084	missense	probably damaging	0.96
R2204:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2205:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2285:Tmc1	UTSW	19	20789799	missense	probably damaging	0.96
R4752:Tmc1	UTSW	19	20826649	missense	probably benign	0.35
R4975:Tmc1	UTSW	19	20906955	missense	probably damaging	0.96
R5040:Tmc1	UTSW	19	20824030	missense	possibly damaging	0.68
R5206:Tmc1	UTSW	19	20826660	missense	probably damaging	1.00
R5400:Tmc1	UTSW	19	20804602	missense	probably damaging	1.00
R5429:Tmc1	UTSW	19	20789622	missense	possibly damaging	0.72
R6200:Tmc1	UTSW	19	20789590	missense	possibly damaging	0.53
R6784:Tmc1	UTSW	19	20827651	critical splice donor site	probably null
R6796:Tmc1	UTSW	19	20799036	missense	probably damaging	1.00
R6808:Tmc1	UTSW	19	20795516	missense	probably damaging	0.99
R6812:Tmc1	UTSW	19	20900861	missense	probably damaging	1.00
R6834:Tmc1	UTSW	19	20795610	nonsense	probably null
R6978:Tmc1	UTSW	19	20804635	missense	probably damaging	1.00
R6986:Tmc1	UTSW	19	20824283	missense	probably benign	0.02
R7027:Tmc1	UTSW	19	20940903	critical splice donor site	probably null
R7378:Tmc1	UTSW	19	20868389	missense	probably damaging	0.98
R7520:Tmc1	UTSW	19	20799178	missense	probably damaging	0.99
R7573:Tmc1	UTSW	19	20907008	missense	probably damaging	0.98
R7825:Tmc1	UTSW	19	20804645	missense	possibly damaging	0.55
R8024:Tmc1	UTSW	19	20900817	missense	probably damaging	1.00
R8073:Tmc1	UTSW	19	20868361	missense	probably benign	0.08
R8786:Tmc1	UTSW	19	20826589	missense	probably damaging	1.00
R8791:Tmc1	UTSW	19	20789845	missense	probably benign	0.00
R8969:Tmc1	UTSW	19	20816229	missense	probably damaging	1.00
R8973:Tmc1	UTSW	19	20900851	missense	probably benign
R9429:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
Z1176:Tmc1	UTSW	19	20826506	missense	probably null	1.00
Z1177:Tmc1	UTSW	19	20795608	missense	possibly damaging	0.47
Z1177:Tmc1	UTSW	19	20823982	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACAACGATGGAGTCAAGC -3'
(R):5'- AAGTGAACCCTGCTGTTATGCC -3'

Sequencing Primer
(F):5'- CAACGATGGAGTCAAGCTTTGC -3'
(R):5'- TGCCATTTTTACAGAACAGCAG -3'

Posted On

2015-07-21