Incidental Mutation 'R4506:Tomm34'
ID332002
Institutional Source Beutler Lab
Gene Symbol Tomm34
Ensembl Gene ENSMUSG00000018322
Gene Nametranslocase of outer mitochondrial membrane 34
Synonyms2610100K07Rik, TOM34
MMRRC Submission 041584-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R4506 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164053540-164071169 bp(-) (GRCm38)
Type of Mutationunclassified (3834 bp from exon)
DNA Base Change (assembly) C to A at 164054372 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018466] [ENSMUST00000067715] [ENSMUST00000109384]
Predicted Effect probably benign
Transcript: ENSMUST00000018466
SMART Domains Protein: ENSMUSP00000018466
Gene: ENSMUSG00000018322

DomainStartEndE-ValueType
TPR 9 42 1.4e1 SMART
TPR 51 84 4.21e-3 SMART
TPR 85 118 2.55e-2 SMART
low complexity region 167 182 N/A INTRINSIC
TPR 193 226 1.56e1 SMART
TPR 227 260 5.51e-7 SMART
TPR 261 294 3.67e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000067715
SMART Domains Protein: ENSMUSP00000096701
Gene: ENSMUSG00000054582

DomainStartEndE-ValueType
RRM 12 85 2.3e-23 SMART
RRM 100 171 1.84e-22 SMART
RRM 192 264 2.31e-28 SMART
RRM 295 366 7.07e-24 SMART
SCOP:d1g9la_ 425 478 1e-6 SMART
PolyA 535 598 8.33e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109384
SMART Domains Protein: ENSMUSP00000105010
Gene: ENSMUSG00000018322

DomainStartEndE-ValueType
TPR 9 42 1.73e1 SMART
TPR 51 84 4.21e-3 SMART
TPR 85 118 2.55e-2 SMART
low complexity region 167 182 N/A INTRINSIC
TPR 193 226 1.56e1 SMART
TPR 227 260 5.51e-7 SMART
TPR 261 294 3.67e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150523
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the import of precursor proteins into mitochondria. The encoded protein has a chaperone-like activity, binding the mature portion of unfolded proteins and aiding their import into mitochondria. This protein, which is found in the cytoplasm and sometimes associated with the outer mitochondrial membrane, has a weak ATPase activity and contains 6 TPR repeats. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and males do not display any defects in the testes or in spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Anapc4 A T 5: 52,835,730 N61I possibly damaging Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Fgfr3 A G 5: 33,729,999 T221A probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ip6k3 A T 17: 27,145,180 L298Q possibly damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr393 A T 11: 73,847,695 C143* probably null Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc7a5 A T 8: 121,887,495 probably null Het
Slc7a9 A T 7: 35,453,420 T88S probably damaging Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Vmn2r23 A T 6: 123,702,925 Q35H probably damaging Het
Wdtc1 C T 4: 133,308,819 V137M probably damaging Het
Zfp276 G A 8: 123,264,927 probably null Het
Zfp90 C T 8: 106,424,864 P403L possibly damaging Het
Other mutations in Tomm34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Tomm34 APN 2 164058662 splice site probably benign
IGL02426:Tomm34 APN 2 164064955 missense probably damaging 1.00
R0744:Tomm34 UTSW 2 164070976 missense probably benign 0.34
R1938:Tomm34 UTSW 2 164061006 missense probably benign 0.00
R4541:Tomm34 UTSW 2 164054799 missense probably benign 0.03
R4869:Tomm34 UTSW 2 164054717 missense probably damaging 1.00
R5080:Tomm34 UTSW 2 164070896 intron probably benign
R6106:Tomm34 UTSW 2 164060991 missense probably benign
R7037:Tomm34 UTSW 2 164070478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTGTTGACAAGGGCCAG -3'
(R):5'- GCAGCTGTCATCTGTCTGTC -3'

Sequencing Primer
(F):5'- ACAAAAACCTCTAGTGGGGAC -3'
(R):5'- AGCTGTCATCTGTCTGTCCATCC -3'
Posted On2015-07-21