Incidental Mutation 'R4506:Slc25a51'
ID332004
Institutional Source Beutler Lab
Gene Symbol Slc25a51
Ensembl Gene ENSMUSG00000045973
Gene Namesolute carrier family 25, member 51
Synonyms
MMRRC Submission 041584-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R4506 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45395923-45408766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45399768 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 141 (V141M)
Ref Sequence ENSEMBL: ENSMUSP00000122620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107796] [ENSMUST00000116341] [ENSMUST00000132815] [ENSMUST00000151516] [ENSMUST00000153904]
Predicted Effect probably benign
Transcript: ENSMUST00000107796
AA Change: V141M

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103425
Gene: ENSMUSG00000045973
AA Change: V141M

DomainStartEndE-ValueType
Pfam:Mito_carr 44 130 4.7e-11 PFAM
Pfam:Mito_carr 132 223 3.5e-11 PFAM
Pfam:Mito_carr 225 315 5.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116341
AA Change: V124M

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112044
Gene: ENSMUSG00000045973
AA Change: V124M

DomainStartEndE-ValueType
Pfam:Mito_carr 27 113 7.4e-12 PFAM
Pfam:Mito_carr 115 206 5.5e-12 PFAM
Pfam:Mito_carr 208 298 8.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132815
AA Change: V124M

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134132
Gene: ENSMUSG00000045973
AA Change: V124M

DomainStartEndE-ValueType
Pfam:Mito_carr 27 113 7.4e-12 PFAM
Pfam:Mito_carr 115 206 5.5e-12 PFAM
Pfam:Mito_carr 208 298 8.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151516
AA Change: V141M

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134108
Gene: ENSMUSG00000045973
AA Change: V141M

DomainStartEndE-ValueType
Pfam:Mito_carr 44 130 1.7e-11 PFAM
Pfam:Mito_carr 132 196 1.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153904
AA Change: V141M

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122620
Gene: ENSMUSG00000045973
AA Change: V141M

DomainStartEndE-ValueType
Pfam:Mito_carr 44 130 2e-11 PFAM
Pfam:Mito_carr 132 206 3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175444
Meta Mutation Damage Score 0.1604 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Anapc4 A T 5: 52,835,730 N61I possibly damaging Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Fgfr3 A G 5: 33,729,999 T221A probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ip6k3 A T 17: 27,145,180 L298Q possibly damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr393 A T 11: 73,847,695 C143* probably null Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Slc7a5 A T 8: 121,887,495 probably null Het
Slc7a9 A T 7: 35,453,420 T88S probably damaging Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Tomm34 C A 2: 164,054,372 probably null Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Vmn2r23 A T 6: 123,702,925 Q35H probably damaging Het
Wdtc1 C T 4: 133,308,819 V137M probably damaging Het
Zfp276 G A 8: 123,264,927 probably null Het
Zfp90 C T 8: 106,424,864 P403L possibly damaging Het
Other mutations in Slc25a51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02417:Slc25a51 APN 4 45400074 missense probably benign 0.03
R4284:Slc25a51 UTSW 4 45399768 missense probably benign 0.43
R4285:Slc25a51 UTSW 4 45399768 missense probably benign 0.43
R4287:Slc25a51 UTSW 4 45399768 missense probably benign 0.43
R4505:Slc25a51 UTSW 4 45399768 missense probably benign 0.43
R6819:Slc25a51 UTSW 4 45399365 missense possibly damaging 0.95
R7387:Slc25a51 UTSW 4 45399841 missense possibly damaging 0.95
R7432:Slc25a51 UTSW 4 45399765 missense possibly damaging 0.95
R8094:Slc25a51 UTSW 4 45399783 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCGGAAAAGGATGGGCAC -3'
(R):5'- CTTACCCGGTTCAGAAGATCCTC -3'

Sequencing Primer
(F):5'- ACCATGCCTCGGTAATACTCTG -3'
(R):5'- GCAGCTTTACGGCATCAAG -3'
Posted On2015-07-21