Incidental Mutation 'R4506:Wdtc1'
ID332005
Institutional Source Beutler Lab
Gene Symbol Wdtc1
Ensembl Gene ENSMUSG00000037622
Gene NameWD and tetratricopeptide repeats 1
Synonymsadipose, LOC230796, adp
MMRRC Submission 041584-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4506 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location133292459-133353481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 133308819 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 137 (V137M)
Ref Sequence ENSEMBL: ENSMUSP00000101526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043305] [ENSMUST00000105906]
Predicted Effect probably damaging
Transcript: ENSMUST00000043305
AA Change: V137M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040647
Gene: ENSMUSG00000037622
AA Change: V137M

DomainStartEndE-ValueType
WD40 36 75 4.58e-8 SMART
WD40 79 120 1.24e-4 SMART
WD40 123 163 2.58e-1 SMART
WD40 170 213 4.42e1 SMART
Pfam:TPR_11 362 429 1.1e-15 PFAM
Pfam:TPR_2 432 457 1.1e-3 PFAM
low complexity region 488 499 N/A INTRINSIC
WD40 523 566 7.16e-1 SMART
WD40 569 608 1.55e-5 SMART
low complexity region 655 670 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105906
AA Change: V137M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101526
Gene: ENSMUSG00000037622
AA Change: V137M

DomainStartEndE-ValueType
WD40 36 75 4.58e-8 SMART
WD40 79 120 1.24e-4 SMART
WD40 123 163 2.58e-1 SMART
WD40 170 213 4.42e1 SMART
Blast:WD40 261 296 5e-12 BLAST
Pfam:TPR_11 361 429 2.9e-16 PFAM
Pfam:TPR_2 432 457 1.4e-3 PFAM
low complexity region 488 499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145426
Meta Mutation Damage Score 0.4563 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: Mice heterozygous for a gene trapped allele are obese and insulin resistant with significantly elevated plasma insulin and leptin levels. Although a number of adult homozygotes are also described as obese, the majority of homozygotes die in utero thus precluding statistically significant analyses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Anapc4 A T 5: 52,835,730 N61I possibly damaging Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Fgfr3 A G 5: 33,729,999 T221A probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ip6k3 A T 17: 27,145,180 L298Q possibly damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr393 A T 11: 73,847,695 C143* probably null Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc7a5 A T 8: 121,887,495 probably null Het
Slc7a9 A T 7: 35,453,420 T88S probably damaging Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Tomm34 C A 2: 164,054,372 probably null Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Vmn2r23 A T 6: 123,702,925 Q35H probably damaging Het
Zfp276 G A 8: 123,264,927 probably null Het
Zfp90 C T 8: 106,424,864 P403L possibly damaging Het
Other mutations in Wdtc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Wdtc1 APN 4 133295232 missense probably damaging 1.00
IGL02005:Wdtc1 APN 4 133308914 missense probably benign 0.14
IGL02078:Wdtc1 APN 4 133305960 missense probably damaging 1.00
IGL02146:Wdtc1 APN 4 133301765 missense probably benign 0.00
IGL02724:Wdtc1 APN 4 133297478 missense possibly damaging 0.78
IGL03196:Wdtc1 APN 4 133295337 missense probably damaging 1.00
pear UTSW 4 133294391 splice site probably null
R0448:Wdtc1 UTSW 4 133297500 missense probably damaging 1.00
R0501:Wdtc1 UTSW 4 133308840 missense possibly damaging 0.88
R0743:Wdtc1 UTSW 4 133300661 missense probably damaging 0.99
R1170:Wdtc1 UTSW 4 133297546 missense probably damaging 0.99
R1439:Wdtc1 UTSW 4 133301807 missense probably benign
R1456:Wdtc1 UTSW 4 133297428 missense possibly damaging 0.83
R1833:Wdtc1 UTSW 4 133308742 splice site probably benign
R4687:Wdtc1 UTSW 4 133296431 missense probably damaging 1.00
R4739:Wdtc1 UTSW 4 133301799 missense possibly damaging 0.68
R4967:Wdtc1 UTSW 4 133294343 missense probably damaging 0.99
R5032:Wdtc1 UTSW 4 133308851 missense possibly damaging 0.89
R5193:Wdtc1 UTSW 4 133294367 nonsense probably null
R5448:Wdtc1 UTSW 4 133294297 missense probably benign
R5593:Wdtc1 UTSW 4 133294391 splice site probably null
R5890:Wdtc1 UTSW 4 133294362 missense unknown
R7536:Wdtc1 UTSW 4 133295250 missense probably damaging 1.00
R7609:Wdtc1 UTSW 4 133296437 missense probably damaging 1.00
R8127:Wdtc1 UTSW 4 133302382 critical splice donor site probably null
R8129:Wdtc1 UTSW 4 133304149 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCGTGTCTGAAGGGAACAG -3'
(R):5'- CAGGCCATTCTCCTTCAGTAGC -3'

Sequencing Primer
(F):5'- TCTGAAGGGAACAGGGCAAAC -3'
(R):5'- AGTAGCCAGCTCTCTCCTATC -3'
Posted On2015-07-21