Incidental Mutation 'R4506:Fgfr3'
ID332006
Institutional Source Beutler Lab
Gene Symbol Fgfr3
Ensembl Gene ENSMUSG00000054252
Gene Namefibroblast growth factor receptor 3
Synonymssam3, Fgfr-3, HBGFR
MMRRC Submission 041584-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R4506 (G1)
Quality Score173
Status Validated
Chromosome5
Chromosomal Location33721674-33737068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33729999 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 221 (T221A)
Ref Sequence ENSEMBL: ENSMUSP00000130856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067150] [ENSMUST00000087820] [ENSMUST00000114411] [ENSMUST00000155002] [ENSMUST00000164207] [ENSMUST00000169212] [ENSMUST00000171509] [ENSMUST00000202138] [ENSMUST00000201295] [ENSMUST00000201437]
Predicted Effect probably damaging
Transcript: ENSMUST00000067150
AA Change: T221A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070998
Gene: ENSMUSG00000054252
AA Change: T221A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 340 3.28e-8 SMART
transmembrane domain 367 389 N/A INTRINSIC
TyrKc 466 742 3.14e-153 SMART
low complexity region 765 781 N/A INTRINSIC
low complexity region 789 798 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087820
AA Change: T203A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085122
Gene: ENSMUSG00000054252
AA Change: T203A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
IGc2 143 211 1.2e-15 SMART
IGc2 242 322 3.28e-8 SMART
transmembrane domain 349 371 N/A INTRINSIC
TyrKc 448 724 3.14e-153 SMART
low complexity region 747 763 N/A INTRINSIC
low complexity region 771 780 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114411
AA Change: T221A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110053
Gene: ENSMUSG00000054252
AA Change: T221A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 339 2.77e-6 SMART
transmembrane domain 369 391 N/A INTRINSIC
TyrKc 468 744 3.14e-153 SMART
low complexity region 767 783 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152661
Predicted Effect probably benign
Transcript: ENSMUST00000155002
Predicted Effect probably damaging
Transcript: ENSMUST00000164207
AA Change: T221A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133064
Gene: ENSMUSG00000054252
AA Change: T221A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 340 3.28e-8 SMART
transmembrane domain 367 389 N/A INTRINSIC
TyrKc 467 743 3.14e-153 SMART
low complexity region 766 782 N/A INTRINSIC
low complexity region 790 799 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169212
AA Change: T221A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130856
Gene: ENSMUSG00000054252
AA Change: T221A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 340 3.28e-8 SMART
transmembrane domain 367 389 N/A INTRINSIC
TyrKc 466 742 3.14e-153 SMART
low complexity region 765 781 N/A INTRINSIC
low complexity region 789 798 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171509
AA Change: T221A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131845
Gene: ENSMUSG00000054252
AA Change: T221A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 339 2.77e-6 SMART
transmembrane domain 369 391 N/A INTRINSIC
TyrKc 468 744 3.14e-153 SMART
low complexity region 767 783 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000181298
AA Change: T59A
Predicted Effect probably damaging
Transcript: ENSMUST00000202138
AA Change: T203A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143945
Gene: ENSMUSG00000054252
AA Change: T203A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
IGc2 143 211 1.2e-15 SMART
IGc2 242 322 3.28e-8 SMART
transmembrane domain 349 371 N/A INTRINSIC
TyrKc 448 724 3.14e-153 SMART
low complexity region 747 763 N/A INTRINSIC
low complexity region 771 780 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000202182
AA Change: T214A
Predicted Effect probably benign
Transcript: ENSMUST00000201295
SMART Domains Protein: ENSMUSP00000144104
Gene: ENSMUSG00000054252

DomainStartEndE-ValueType
IG 11 71 1.9e-3 SMART
transmembrane domain 90 112 N/A INTRINSIC
PDB:2PSQ|B 126 223 2e-30 PDB
Blast:IG_like 140 223 2e-51 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000202791
Predicted Effect probably benign
Transcript: ENSMUST00000201437
SMART Domains Protein: ENSMUSP00000144379
Gene: ENSMUSG00000054252

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 2e-6 SMART
Pfam:Ig_3 144 194 2.1e-3 PFAM
Pfam:I-set 153 194 9.2e-6 PFAM
Meta Mutation Damage Score 0.9190 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: This gene encodes a member of the fibroblast growth factor receptor family. Members of this family are highly conserved proteins that differ from one another in their ligand affinities and tissue distribution. A representative protein consists of an extracellular region composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment, and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This family member binds acidic and basic fibroblast growth hormone and plays a role in bone development and maintenance. Mutations in this gene may be associated with craniosynostosis and multiple types of skeletal dysplasia. A pseudogene of this gene is located on chromosome 1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mutant alleles generally cause skeletal deformities, with some causing decreased body size, premature death, or hearing loss due to developmental defects of the ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Anapc4 A T 5: 52,835,730 N61I possibly damaging Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ip6k3 A T 17: 27,145,180 L298Q possibly damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr393 A T 11: 73,847,695 C143* probably null Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc7a5 A T 8: 121,887,495 probably null Het
Slc7a9 A T 7: 35,453,420 T88S probably damaging Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Tomm34 C A 2: 164,054,372 probably null Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Vmn2r23 A T 6: 123,702,925 Q35H probably damaging Het
Wdtc1 C T 4: 133,308,819 V137M probably damaging Het
Zfp276 G A 8: 123,264,927 probably null Het
Zfp90 C T 8: 106,424,864 P403L possibly damaging Het
Other mutations in Fgfr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Fgfr3 APN 5 33735140 missense possibly damaging 0.57
IGL01585:Fgfr3 APN 5 33733961 missense probably damaging 0.96
IGL03266:Fgfr3 APN 5 33734365 missense probably damaging 1.00
IGL03285:Fgfr3 APN 5 33735213 missense probably damaging 1.00
PIT4280001:Fgfr3 UTSW 5 33732232 missense probably benign 0.13
R0543:Fgfr3 UTSW 5 33729710 start codon destroyed probably null 0.00
R0604:Fgfr3 UTSW 5 33732782 missense probably damaging 0.99
R1496:Fgfr3 UTSW 5 33729750 missense probably damaging 0.96
R1861:Fgfr3 UTSW 5 33729746 missense probably damaging 1.00
R2919:Fgfr3 UTSW 5 33733940 missense probably damaging 1.00
R2920:Fgfr3 UTSW 5 33733940 missense probably damaging 1.00
R4361:Fgfr3 UTSW 5 33723332 intron probably benign
R4513:Fgfr3 UTSW 5 33723116 intron probably benign
R4647:Fgfr3 UTSW 5 33734986 unclassified probably benign
R5240:Fgfr3 UTSW 5 33730038 missense probably damaging 1.00
R5251:Fgfr3 UTSW 5 33735556 unclassified probably benign
R5454:Fgfr3 UTSW 5 33723298 intron probably benign
R5595:Fgfr3 UTSW 5 33730003 missense probably damaging 1.00
R5984:Fgfr3 UTSW 5 33729705 missense probably damaging 1.00
R6753:Fgfr3 UTSW 5 33732159 missense probably benign 0.35
R6985:Fgfr3 UTSW 5 33735441 missense probably null 1.00
R7106:Fgfr3 UTSW 5 33731414 missense probably damaging 1.00
R7221:Fgfr3 UTSW 5 33732748 frame shift probably null
R7319:Fgfr3 UTSW 5 33727802 missense possibly damaging 0.88
R7373:Fgfr3 UTSW 5 33727690 missense probably benign 0.00
R7497:Fgfr3 UTSW 5 33735422 frame shift probably null
R7498:Fgfr3 UTSW 5 33735422 frame shift probably null
R7499:Fgfr3 UTSW 5 33735422 frame shift probably null
R7883:Fgfr3 UTSW 5 33733891 missense probably damaging 1.00
R8129:Fgfr3 UTSW 5 33733906 missense probably damaging 0.98
R8179:Fgfr3 UTSW 5 33727755 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAATTCCGAGGGGAGCATC -3'
(R):5'- CCACGTCACTGCCTAGAATG -3'

Sequencing Primer
(F):5'- CATCGCATTGGGGGCATCAAG -3'
(R):5'- CCTAGAATGGCTGTCTGGTTG -3'
Posted On2015-07-21