Incidental Mutation 'R4506:Anapc4'
ID332007
Institutional Source Beutler Lab
Gene Symbol Anapc4
Ensembl Gene ENSMUSG00000029176
Gene Nameanaphase promoting complex subunit 4
Synonyms2610306D21Rik, D5Ertd249e, APC4
MMRRC Submission 041584-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4506 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location52834012-52867797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52835730 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 61 (N61I)
Ref Sequence ENSEMBL: ENSMUSP00000031072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031072] [ENSMUST00000144574]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031072
AA Change: N61I

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031072
Gene: ENSMUSG00000029176
AA Change: N61I

DomainStartEndE-ValueType
Pfam:ANAPC4_WD40 10 57 9.1e-18 PFAM
low complexity region 137 147 N/A INTRINSIC
Pfam:ANAPC4 232 431 3.7e-61 PFAM
low complexity region 747 763 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144574
AA Change: N61I

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114475
Gene: ENSMUSG00000029176
AA Change: N61I

DomainStartEndE-ValueType
Pfam:Apc4_WD40 10 57 4e-20 PFAM
Meta Mutation Damage Score 0.1184 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The exact function of this gene product is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Fgfr3 A G 5: 33,729,999 T221A probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ip6k3 A T 17: 27,145,180 L298Q possibly damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr393 A T 11: 73,847,695 C143* probably null Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc7a5 A T 8: 121,887,495 probably null Het
Slc7a9 A T 7: 35,453,420 T88S probably damaging Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Tomm34 C A 2: 164,054,372 probably null Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Vmn2r23 A T 6: 123,702,925 Q35H probably damaging Het
Wdtc1 C T 4: 133,308,819 V137M probably damaging Het
Zfp276 G A 8: 123,264,927 probably null Het
Zfp90 C T 8: 106,424,864 P403L possibly damaging Het
Other mutations in Anapc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Anapc4 APN 5 52857211 missense probably damaging 0.98
IGL01066:Anapc4 APN 5 52857209 missense probably benign 0.08
IGL01109:Anapc4 APN 5 52848628 missense probably damaging 1.00
IGL01657:Anapc4 APN 5 52864626 nonsense probably null
IGL02692:Anapc4 APN 5 52864529 missense probably damaging 0.98
IGL02734:Anapc4 APN 5 52861291 missense probably benign 0.04
IGL03089:Anapc4 APN 5 52866398 missense probably benign 0.32
IGL03096:Anapc4 APN 5 52865929 missense possibly damaging 0.57
FR4304:Anapc4 UTSW 5 52864526 missense probably damaging 1.00
IGL03048:Anapc4 UTSW 5 52839733 missense probably benign 0.00
R0331:Anapc4 UTSW 5 52855642 splice site probably benign
R0511:Anapc4 UTSW 5 52842017 unclassified probably benign
R0624:Anapc4 UTSW 5 52845419 splice site probably benign
R0919:Anapc4 UTSW 5 52855637 missense probably benign 0.18
R1935:Anapc4 UTSW 5 52839668 missense probably damaging 0.99
R1936:Anapc4 UTSW 5 52839668 missense probably damaging 0.99
R1942:Anapc4 UTSW 5 52846714 missense probably benign 0.30
R1953:Anapc4 UTSW 5 52839688 missense probably damaging 1.00
R1954:Anapc4 UTSW 5 52846625 intron probably benign
R2341:Anapc4 UTSW 5 52841937 unclassified probably benign
R3696:Anapc4 UTSW 5 52862009 missense probably null 0.01
R4596:Anapc4 UTSW 5 52841718 missense probably benign 0.00
R5234:Anapc4 UTSW 5 52848776 missense probably damaging 1.00
R5256:Anapc4 UTSW 5 52863594 missense probably benign
R5310:Anapc4 UTSW 5 52859159 missense probably benign 0.00
R5401:Anapc4 UTSW 5 52863649 missense probably benign 0.01
R5409:Anapc4 UTSW 5 52848599 missense probably damaging 0.98
R5525:Anapc4 UTSW 5 52856809 missense probably damaging 1.00
R5575:Anapc4 UTSW 5 52855871 missense probably damaging 1.00
R5604:Anapc4 UTSW 5 52841734 nonsense probably null
R5695:Anapc4 UTSW 5 52862239 missense probably benign 0.00
R5955:Anapc4 UTSW 5 52865946 missense probably benign 0.01
R5974:Anapc4 UTSW 5 52845400 missense probably damaging 1.00
R6458:Anapc4 UTSW 5 52864553 missense possibly damaging 0.80
R6537:Anapc4 UTSW 5 52843556 missense probably damaging 0.98
R6633:Anapc4 UTSW 5 52865946 missense possibly damaging 0.85
R6860:Anapc4 UTSW 5 52848828 missense probably damaging 1.00
R6965:Anapc4 UTSW 5 52835751 missense possibly damaging 0.89
R7067:Anapc4 UTSW 5 52862235 missense probably benign
R7327:Anapc4 UTSW 5 52845330 missense probably damaging 0.99
R7442:Anapc4 UTSW 5 52857201 missense probably benign 0.08
R7837:Anapc4 UTSW 5 52859208 critical splice donor site probably null
R8382:Anapc4 UTSW 5 52858935 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACATTCGTTTGGACACTGTTG -3'
(R):5'- CTGCCAACAACAGACTTTCATG -3'

Sequencing Primer
(F):5'- GACACTGTTGTTCTGTAGATTGC -3'
(R):5'- CTGGTTTACACAAAGAGTCCTAGGC -3'
Posted On2015-07-21