Incidental Mutation 'R4506:Vmn2r23'
ID 332012
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission 041584-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R4506 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 123679780-123719198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123679884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 35 (Q35H)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect probably damaging
Transcript: ENSMUST00000172391
AA Change: Q35H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: Q35H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,685,087 (GRCm39) P137T probably damaging Het
Abcc5 A T 16: 20,152,445 (GRCm39) I1367N probably damaging Het
Ace T A 11: 105,867,492 (GRCm39) L152Q probably damaging Het
Adam19 G A 11: 46,009,271 (GRCm39) D232N possibly damaging Het
Anapc4 A T 5: 52,993,072 (GRCm39) N61I possibly damaging Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Atr T A 9: 95,747,290 (GRCm39) C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,736,933 (GRCm39) probably benign Het
Cnot6l A T 5: 96,234,033 (GRCm39) V326E possibly damaging Het
Fcer2a A T 8: 3,738,603 (GRCm39) probably null Het
Fgfr3 A G 5: 33,887,343 (GRCm39) T221A probably damaging Het
Gm6632 C T 5: 59,211,821 (GRCm39) noncoding transcript Het
Gpr158 T A 2: 21,831,810 (GRCm39) M970K probably damaging Het
H2-T5 A T 17: 36,472,372 (GRCm39) probably benign Het
Ip6k3 A T 17: 27,364,154 (GRCm39) L298Q possibly damaging Het
Itpr1 A G 6: 108,409,647 (GRCm39) D1727G probably damaging Het
Kdm2b T C 5: 123,026,688 (GRCm39) T589A possibly damaging Het
Krtcap2 A G 3: 89,153,563 (GRCm39) probably benign Het
Map3k13 A G 16: 21,740,928 (GRCm39) S752G probably benign Het
Mvb12a G T 8: 71,996,103 (GRCm39) A86S probably benign Het
Nktr T A 9: 121,577,949 (GRCm39) probably benign Het
Or1e33 A T 11: 73,738,521 (GRCm39) C143* probably null Het
Or8a1b C T 9: 37,622,760 (GRCm39) V272I probably benign Het
Parp4 T A 14: 56,889,761 (GRCm39) N1847K unknown Het
Pcdhga8 G C 18: 37,949,816 (GRCm39) V411L probably damaging Het
Piwil4 T C 9: 14,637,259 (GRCm39) T352A probably damaging Het
Ric8a A G 7: 140,438,429 (GRCm39) I223V probably benign Het
Slc25a51 C T 4: 45,399,768 (GRCm39) V141M probably benign Het
Slc7a5 A T 8: 122,614,234 (GRCm39) probably null Het
Slc7a9 A T 7: 35,152,845 (GRCm39) T88S probably damaging Het
Tbrg1 T A 9: 37,565,691 (GRCm39) E87V probably damaging Het
Tnfsf4 T C 1: 161,244,745 (GRCm39) S145P probably damaging Het
Tomm34 C A 2: 163,896,292 (GRCm39) probably null Het
Trpv3 A G 11: 73,186,150 (GRCm39) N647S probably benign Het
Upf1 G A 8: 70,790,216 (GRCm39) R637C probably damaging Het
Wdtc1 C T 4: 133,036,130 (GRCm39) V137M probably damaging Het
Zfp276 G A 8: 123,991,666 (GRCm39) probably null Het
Zfp90 C T 8: 107,151,496 (GRCm39) P403L possibly damaging Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123,706,684 (GRCm39) missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123,706,555 (GRCm39) missense probably benign
IGL01073:Vmn2r23 APN 6 123,689,759 (GRCm39) missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123,681,383 (GRCm39) missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123,681,366 (GRCm39) missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123,718,845 (GRCm39) missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123,718,819 (GRCm39) missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123,718,703 (GRCm39) missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123,718,795 (GRCm39) missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123,681,437 (GRCm39) missense probably benign
IGL02831:Vmn2r23 APN 6 123,681,344 (GRCm39) missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123,681,355 (GRCm39) missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123,718,578 (GRCm39) missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123,718,741 (GRCm39) missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123,681,333 (GRCm39) missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123,706,585 (GRCm39) missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123,706,680 (GRCm39) missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123,719,094 (GRCm39) missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123,718,963 (GRCm39) missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123,690,229 (GRCm39) nonsense probably null
R1629:Vmn2r23 UTSW 6 123,690,386 (GRCm39) missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123,706,649 (GRCm39) missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123,679,874 (GRCm39) missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123,689,969 (GRCm39) missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123,718,458 (GRCm39) missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123,681,384 (GRCm39) missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123,719,147 (GRCm39) nonsense probably null
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123,690,129 (GRCm39) missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123,718,348 (GRCm39) missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123,706,697 (GRCm39) missense probably benign
R4652:Vmn2r23 UTSW 6 123,718,689 (GRCm39) missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123,718,785 (GRCm39) missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123,710,308 (GRCm39) missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123,689,961 (GRCm39) missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R5761:Vmn2r23 UTSW 6 123,689,718 (GRCm39) missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123,689,901 (GRCm39) missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123,718,854 (GRCm39) missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123,681,359 (GRCm39) missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123,689,861 (GRCm39) missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123,690,384 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R6925:Vmn2r23 UTSW 6 123,681,512 (GRCm39) missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123,689,981 (GRCm39) missense probably benign
R7215:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123,718,540 (GRCm39) missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123,681,538 (GRCm39) missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123,681,500 (GRCm39) missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123,718,312 (GRCm39) missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123,681,599 (GRCm39) missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123,718,615 (GRCm39) missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123,690,431 (GRCm39) missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123,679,991 (GRCm39) missense
R8966:Vmn2r23 UTSW 6 123,719,079 (GRCm39) missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123,719,038 (GRCm39) missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123,718,782 (GRCm39) missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123,690,075 (GRCm39) missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123,690,120 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123,719,067 (GRCm39) missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123,706,684 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTTGACCCACATGGACCAG -3'
(R):5'- CTCCATGAAGTTGAAGACAGGAGAC -3'

Sequencing Primer
(F):5'- GGACCAGAAAGGCACATGTTTTATC -3'
(R):5'- CAGTAGAGCTGGGAGAGATCAAC -3'
Posted On 2015-07-21