Incidental Mutation 'R4506:Slc7a9'
ID332013
Institutional Source Beutler Lab
Gene Symbol Slc7a9
Ensembl Gene ENSMUSG00000030492
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 9
Synonymsb, + amino acid transporter, CSNU3, b, +AT
MMRRC Submission 041584-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R4506 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location35448796-35466036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35453420 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 88 (T88S)
Ref Sequence ENSEMBL: ENSMUSP00000112726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032703] [ENSMUST00000118383] [ENSMUST00000118969] [ENSMUST00000141245]
Predicted Effect probably damaging
Transcript: ENSMUST00000032703
AA Change: T88S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032703
Gene: ENSMUSG00000030492
AA Change: T88S

DomainStartEndE-ValueType
Pfam:AA_permease_2 30 456 9e-67 PFAM
Pfam:AA_permease 35 468 4.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118383
AA Change: T88S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113181
Gene: ENSMUSG00000030492
AA Change: T88S

DomainStartEndE-ValueType
Pfam:AA_permease_2 30 456 9e-67 PFAM
Pfam:AA_permease 35 468 4.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118969
AA Change: T88S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112726
Gene: ENSMUSG00000030492
AA Change: T88S

DomainStartEndE-ValueType
Pfam:AA_permease_2 30 457 1.8e-65 PFAM
Pfam:AA_permease 35 468 2.2e-24 PFAM
Predicted Effect silent
Transcript: ENSMUST00000141245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147026
Meta Mutation Damage Score 0.1847 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of light subunits of amino acid transporters. This protein plays a role in the high-affinity and sodium-independent transport of cystine and neutral and dibasic amino acids, and appears to function in the reabsorption of cystine in the kidney tubule. Mutations in this gene cause non-type I cystinuria, a disease that leads to cystine stones in the urinary system due to impaired transport of cystine and dibasic amino acids. Alternate transcript variants, which encode the same protein, have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Inactivation of this locus leads to renal absorption defects and cystine urolithiasis, similar to the symptoms observed in patients with cystinuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Anapc4 A T 5: 52,835,730 N61I possibly damaging Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Fgfr3 A G 5: 33,729,999 T221A probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ip6k3 A T 17: 27,145,180 L298Q possibly damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr393 A T 11: 73,847,695 C143* probably null Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc7a5 A T 8: 121,887,495 probably null Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Tomm34 C A 2: 164,054,372 probably null Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Vmn2r23 A T 6: 123,702,925 Q35H probably damaging Het
Wdtc1 C T 4: 133,308,819 V137M probably damaging Het
Zfp276 G A 8: 123,264,927 probably null Het
Zfp90 C T 8: 106,424,864 P403L possibly damaging Het
Other mutations in Slc7a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Slc7a9 APN 7 35460887 missense probably damaging 0.97
IGL01538:Slc7a9 APN 7 35454164 missense probably damaging 0.97
IGL01860:Slc7a9 APN 7 35457060 missense probably damaging 1.00
IGL02291:Slc7a9 APN 7 35457014 missense probably damaging 1.00
IGL02436:Slc7a9 APN 7 35457053 missense probably benign 0.23
IGL02525:Slc7a9 APN 7 35453435 missense probably damaging 1.00
IGL03296:Slc7a9 APN 7 35452427 missense probably damaging 1.00
R0006:Slc7a9 UTSW 7 35470100 unclassified probably benign
R1703:Slc7a9 UTSW 7 35454575 missense probably benign
R1886:Slc7a9 UTSW 7 35453402 missense possibly damaging 0.94
R1886:Slc7a9 UTSW 7 35453403 missense probably damaging 0.96
R1907:Slc7a9 UTSW 7 35449854 missense probably benign 0.00
R2027:Slc7a9 UTSW 7 35454137 missense probably damaging 0.97
R2133:Slc7a9 UTSW 7 35453493 missense probably damaging 0.99
R2937:Slc7a9 UTSW 7 35463742 nonsense probably null
R3684:Slc7a9 UTSW 7 35453501 missense probably benign 0.02
R4731:Slc7a9 UTSW 7 35453563 nonsense probably null
R4732:Slc7a9 UTSW 7 35453563 nonsense probably null
R4733:Slc7a9 UTSW 7 35453563 nonsense probably null
R5007:Slc7a9 UTSW 7 35454129 missense probably benign 0.09
R6175:Slc7a9 UTSW 7 35465852 missense probably damaging 1.00
R6405:Slc7a9 UTSW 7 35454639 missense probably damaging 1.00
R6701:Slc7a9 UTSW 7 35459849 missense probably damaging 1.00
R6932:Slc7a9 UTSW 7 35452511 missense probably benign 0.16
R7760:Slc7a9 UTSW 7 35457075 missense possibly damaging 0.88
R8121:Slc7a9 UTSW 7 35454117 missense probably damaging 1.00
R8177:Slc7a9 UTSW 7 35456133 missense probably benign
R8185:Slc7a9 UTSW 7 35452417 missense probably damaging 1.00
X0022:Slc7a9 UTSW 7 35452502 missense possibly damaging 0.91
Z1177:Slc7a9 UTSW 7 35453570 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CTAGGTGTTGGAACTACATGTTGC -3'
(R):5'- GGCTTGCAACCTGAGTAAAAG -3'

Sequencing Primer
(F):5'- GGAACTACATGTTGCACCATCATG -3'
(R):5'- GGCTGCACACACATACTCTG -3'
Posted On2015-07-21