Mutagenetix > Incidental Mutation

Incidental Mutation 'R4506:Slc7a9'

332013

Institutional Source

Beutler Lab

Gene Symbol

Slc7a9

Ensembl Gene

ENSMUSG00000030492

Gene Name

solute carrier family 7 (cationic amino acid transporter, y+ system), member 9

Synonyms

b, + amino acid transporter, CSNU3, b, +AT

MMRRC Submission

041584-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R4506 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

35448796-35466036 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 35453420 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 88 (T88S)

Ref Sequence

ENSEMBL: ENSMUSP00000112726 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032703] [ENSMUST00000118383] [ENSMUST00000118969] [ENSMUST00000141245]

AlphaFold

Q9QXA6

Predicted Effect

probably damaging
Transcript: ENSMUST00000032703
AA Change: T88S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032703
Gene: ENSMUSG00000030492
AA Change: T88S

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	30	456	9e-67	PFAM
Pfam:AA_permease	35	468	4.8e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000118383
AA Change: T88S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113181
Gene: ENSMUSG00000030492
AA Change: T88S

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	30	456	9e-67	PFAM
Pfam:AA_permease	35	468	4.8e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000118969
AA Change: T88S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112726
Gene: ENSMUSG00000030492
AA Change: T88S

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	30	457	1.8e-65	PFAM
Pfam:AA_permease	35	468	2.2e-24	PFAM

Predicted Effect

silent
Transcript: ENSMUST00000141245

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141905

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147026

Meta Mutation Damage Score

0.1847

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of light subunits of amino acid transporters. This protein plays a role in the high-affinity and sodium-independent transport of cystine and neutral and dibasic amino acids, and appears to function in the reabsorption of cystine in the kidney tubule. Mutations in this gene cause non-type I cystinuria, a disease that leads to cystine stones in the urinary system due to impaired transport of cystine and dibasic amino acids. Alternate transcript variants, which encode the same protein, have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Inactivation of this locus leads to renal absorption defects and cystine urolithiasis, similar to the symptoms observed in patients with cystinuria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,261	P137T	probably damaging	Het
Abcc5	A	T	16: 20,333,695	I1367N	probably damaging	Het
Ace	T	A	11: 105,976,666	L152Q	probably damaging	Het
Adam19	G	A	11: 46,118,444	D232N	possibly damaging	Het
Anapc4	A	T	5: 52,835,730	N61I	possibly damaging	Het
Ap5m1	T	C	14: 49,073,761	V96A	probably damaging	Het
Atr	T	A	9: 95,865,237	C191S	probably benign	Het
Carmil3	GGACGA	GGA	14: 55,499,476		probably benign	Het
Cnot6l	A	T	5: 96,086,174	V326E	possibly damaging	Het
Fcer2a	A	T	8: 3,688,603		probably null	Het
Fgfr3	A	G	5: 33,729,999	T221A	probably damaging	Het
Gm6632	C	T	5: 59,054,478		noncoding transcript	Het
Gm8909	A	T	17: 36,161,480		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Ip6k3	A	T	17: 27,145,180	L298Q	possibly damaging	Het
Itpr1	A	G	6: 108,432,686	D1727G	probably damaging	Het
Kdm2b	T	C	5: 122,888,625	T589A	possibly damaging	Het
Krtcap2	A	G	3: 89,246,256		probably benign	Het
Map3k13	A	G	16: 21,922,178	S752G	probably benign	Het
Mvb12a	G	T	8: 71,543,459	A86S	probably benign	Het
Nktr	T	A	9: 121,748,883		probably benign	Het
Olfr160	C	T	9: 37,711,464	V272I	probably benign	Het
Olfr393	A	T	11: 73,847,695	C143*	probably null	Het
Parp4	T	A	14: 56,652,304	N1847K	unknown	Het
Pcdhga8	G	C	18: 37,816,763	V411L	probably damaging	Het
Piwil4	T	C	9: 14,725,963	T352A	probably damaging	Het
Ric8a	A	G	7: 140,858,516	I223V	probably benign	Het
Slc25a51	C	T	4: 45,399,768	V141M	probably benign	Het
Slc7a5	A	T	8: 121,887,495		probably null	Het
Tbrg1	T	A	9: 37,654,395	E87V	probably damaging	Het
Tnfsf4	T	C	1: 161,417,174	S145P	probably damaging	Het
Tomm34	C	A	2: 164,054,372		probably null	Het
Trpv3	A	G	11: 73,295,324	N647S	probably benign	Het
Upf1	G	A	8: 70,337,566	R637C	probably damaging	Het
Vmn2r23	A	T	6: 123,702,925	Q35H	probably damaging	Het
Wdtc1	C	T	4: 133,308,819	V137M	probably damaging	Het
Zfp276	G	A	8: 123,264,927		probably null	Het
Zfp90	C	T	8: 106,424,864	P403L	possibly damaging	Het

Other mutations in Slc7a9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00486:Slc7a9	APN	7	35460887	missense	probably damaging	0.97
IGL01538:Slc7a9	APN	7	35454164	missense	probably damaging	0.97
IGL01860:Slc7a9	APN	7	35457060	missense	probably damaging	1.00
IGL02291:Slc7a9	APN	7	35457014	missense	probably damaging	1.00
IGL02436:Slc7a9	APN	7	35457053	missense	probably benign	0.23
IGL02525:Slc7a9	APN	7	35453435	missense	probably damaging	1.00
IGL03296:Slc7a9	APN	7	35452427	missense	probably damaging	1.00
R0006:Slc7a9	UTSW	7	35470100	unclassified	probably benign
R1703:Slc7a9	UTSW	7	35454575	missense	probably benign
R1886:Slc7a9	UTSW	7	35453402	missense	possibly damaging	0.94
R1886:Slc7a9	UTSW	7	35453403	missense	probably damaging	0.96
R1907:Slc7a9	UTSW	7	35449854	missense	probably benign	0.00
R2027:Slc7a9	UTSW	7	35454137	missense	probably damaging	0.97
R2133:Slc7a9	UTSW	7	35453493	missense	probably damaging	0.99
R2937:Slc7a9	UTSW	7	35463742	nonsense	probably null
R3684:Slc7a9	UTSW	7	35453501	missense	probably benign	0.02
R4731:Slc7a9	UTSW	7	35453563	nonsense	probably null
R4732:Slc7a9	UTSW	7	35453563	nonsense	probably null
R4733:Slc7a9	UTSW	7	35453563	nonsense	probably null
R5007:Slc7a9	UTSW	7	35454129	missense	probably benign	0.09
R6175:Slc7a9	UTSW	7	35465852	missense	probably damaging	1.00
R6405:Slc7a9	UTSW	7	35454639	missense	probably damaging	1.00
R6701:Slc7a9	UTSW	7	35459849	missense	probably damaging	1.00
R6932:Slc7a9	UTSW	7	35452511	missense	probably benign	0.16
R7760:Slc7a9	UTSW	7	35457075	missense	possibly damaging	0.88
R8121:Slc7a9	UTSW	7	35454117	missense	probably damaging	1.00
R8177:Slc7a9	UTSW	7	35456133	missense	probably benign
R8185:Slc7a9	UTSW	7	35452417	missense	probably damaging	1.00
R8416:Slc7a9	UTSW	7	35453433	missense	probably benign	0.41
R8732:Slc7a9	UTSW	7	35457018	missense	probably benign	0.26
R8803:Slc7a9	UTSW	7	35463718	missense	possibly damaging	0.90
R9052:Slc7a9	UTSW	7	35453592	missense	probably benign	0.03
X0022:Slc7a9	UTSW	7	35452502	missense	possibly damaging	0.91
Z1177:Slc7a9	UTSW	7	35453570	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- CTAGGTGTTGGAACTACATGTTGC -3'
(R):5'- GGCTTGCAACCTGAGTAAAAG -3'

Sequencing Primer
(F):5'- GGAACTACATGTTGCACCATCATG -3'
(R):5'- GGCTGCACACACATACTCTG -3'

Posted On

2015-07-21