Incidental Mutation 'R4506:Ric8a'
ID332014
Institutional Source Beutler Lab
Gene Symbol Ric8a
Ensembl Gene ENSMUSG00000025485
Gene NameRIC8 guanine nucleotide exchange factor A
Synonymssynembryn, RIC-8, Ric8
MMRRC Submission 041584-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4506 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140856957-140864372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140858516 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 223 (I223V)
Ref Sequence ENSEMBL: ENSMUSP00000026558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026557] [ENSMUST00000026558] [ENSMUST00000209320] [ENSMUST00000209690] [ENSMUST00000211624] [ENSMUST00000210710] [ENSMUST00000210708] [ENSMUST00000209766] [ENSMUST00000211527] [ENSMUST00000211590]
Predicted Effect probably benign
Transcript: ENSMUST00000026557
SMART Domains Protein: ENSMUSP00000026557
Gene: ENSMUSG00000025484

DomainStartEndE-ValueType
Pfam:SNARE 20 82 3.4e-13 PFAM
transmembrane domain 87 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026558
AA Change: I223V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000026558
Gene: ENSMUSG00000025485
AA Change: I223V

DomainStartEndE-ValueType
Pfam:Ric8 66 505 2.3e-125 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209318
Predicted Effect probably benign
Transcript: ENSMUST00000209320
Predicted Effect probably benign
Transcript: ENSMUST00000209690
Predicted Effect probably benign
Transcript: ENSMUST00000211624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210195
Predicted Effect probably benign
Transcript: ENSMUST00000210710
Predicted Effect probably benign
Transcript: ENSMUST00000210708
Predicted Effect probably benign
Transcript: ENSMUST00000209766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210157
Predicted Effect probably benign
Transcript: ENSMUST00000211527
Predicted Effect probably benign
Transcript: ENSMUST00000211590
Meta Mutation Damage Score 0.0662 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in lethality during gastrulation. Heterozygotes exhibit impaired spatial learning and increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Anapc4 A T 5: 52,835,730 N61I possibly damaging Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Fgfr3 A G 5: 33,729,999 T221A probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ip6k3 A T 17: 27,145,180 L298Q possibly damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr393 A T 11: 73,847,695 C143* probably null Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc7a5 A T 8: 121,887,495 probably null Het
Slc7a9 A T 7: 35,453,420 T88S probably damaging Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Tomm34 C A 2: 164,054,372 probably null Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Vmn2r23 A T 6: 123,702,925 Q35H probably damaging Het
Wdtc1 C T 4: 133,308,819 V137M probably damaging Het
Zfp276 G A 8: 123,264,927 probably null Het
Zfp90 C T 8: 106,424,864 P403L possibly damaging Het
Other mutations in Ric8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Ric8a APN 7 140862357 missense probably benign 0.00
R0277:Ric8a UTSW 7 140857900 unclassified probably benign
R0529:Ric8a UTSW 7 140860893 missense probably damaging 1.00
R0707:Ric8a UTSW 7 140857973 unclassified probably benign
R1272:Ric8a UTSW 7 140862376 missense probably benign 0.22
R1627:Ric8a UTSW 7 140858178 missense probably damaging 0.98
R1655:Ric8a UTSW 7 140860895 missense probably benign 0.01
R2281:Ric8a UTSW 7 140861938 missense probably benign 0.44
R2327:Ric8a UTSW 7 140859558 missense probably damaging 1.00
R3721:Ric8a UTSW 7 140861961 critical splice donor site probably null
R4287:Ric8a UTSW 7 140861422 missense probably damaging 1.00
R4504:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4505:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4507:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4552:Ric8a UTSW 7 140861337 missense probably damaging 1.00
R5500:Ric8a UTSW 7 140858315 missense probably benign 0.43
R6737:Ric8a UTSW 7 140858876 unclassified probably null
R8150:Ric8a UTSW 7 140861356 missense probably damaging 1.00
R8391:Ric8a UTSW 7 140858003 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCTCCTTTTCCTGCTAACAG -3'
(R):5'- CACTGTGGAGAATACCCACCTG -3'

Sequencing Primer
(F):5'- TAACAGCCCTTCGCACGG -3'
(R):5'- AGGCACCTTCCCTGAGTTC -3'
Posted On2015-07-21