Mutagenetix > Incidental Mutation

Incidental Mutation 'R4506:Upf1'

332016

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

041584-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.972) question?

Stock #

R4506 (G1)

Quality Score

204

Status

Validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 70337566 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 637 (R637C)

Ref Sequence

ENSEMBL: ENSMUSP00000075089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

probably damaging
Transcript: ENSMUST00000075666
AA Change: R637C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: R637C

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215817
AA Change: R626C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Meta Mutation Damage Score

0.8701

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,261	P137T	probably damaging	Het
Abcc5	A	T	16: 20,333,695	I1367N	probably damaging	Het
Ace	T	A	11: 105,976,666	L152Q	probably damaging	Het
Adam19	G	A	11: 46,118,444	D232N	possibly damaging	Het
Anapc4	A	T	5: 52,835,730	N61I	possibly damaging	Het
Ap5m1	T	C	14: 49,073,761	V96A	probably damaging	Het
Atr	T	A	9: 95,865,237	C191S	probably benign	Het
Carmil3	GGACGA	GGA	14: 55,499,476		probably benign	Het
Cnot6l	A	T	5: 96,086,174	V326E	possibly damaging	Het
Fcer2a	A	T	8: 3,688,603		probably null	Het
Fgfr3	A	G	5: 33,729,999	T221A	probably damaging	Het
Gm6632	C	T	5: 59,054,478		noncoding transcript	Het
Gm8909	A	T	17: 36,161,480		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Ip6k3	A	T	17: 27,145,180	L298Q	possibly damaging	Het
Itpr1	A	G	6: 108,432,686	D1727G	probably damaging	Het
Kdm2b	T	C	5: 122,888,625	T589A	possibly damaging	Het
Krtcap2	A	G	3: 89,246,256		probably benign	Het
Map3k13	A	G	16: 21,922,178	S752G	probably benign	Het
Mvb12a	G	T	8: 71,543,459	A86S	probably benign	Het
Nktr	T	A	9: 121,748,883		probably benign	Het
Olfr160	C	T	9: 37,711,464	V272I	probably benign	Het
Olfr393	A	T	11: 73,847,695	C143*	probably null	Het
Parp4	T	A	14: 56,652,304	N1847K	unknown	Het
Pcdhga8	G	C	18: 37,816,763	V411L	probably damaging	Het
Piwil4	T	C	9: 14,725,963	T352A	probably damaging	Het
Ric8a	A	G	7: 140,858,516	I223V	probably benign	Het
Slc25a51	C	T	4: 45,399,768	V141M	probably benign	Het
Slc7a5	A	T	8: 121,887,495		probably null	Het
Slc7a9	A	T	7: 35,453,420	T88S	probably damaging	Het
Tbrg1	T	A	9: 37,654,395	E87V	probably damaging	Het
Tnfsf4	T	C	1: 161,417,174	S145P	probably damaging	Het
Tomm34	C	A	2: 164,054,372		probably null	Het
Trpv3	A	G	11: 73,295,324	N647S	probably benign	Het
Vmn2r23	A	T	6: 123,702,925	Q35H	probably damaging	Het
Wdtc1	C	T	4: 133,308,819	V137M	probably damaging	Het
Zfp276	G	A	8: 123,264,927		probably null	Het
Zfp90	C	T	8: 106,424,864	P403L	possibly damaging	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TCAGTACAGGCTGCCAACAC -3'
(R):5'- TCAGAACAACTTGTGCGGG -3'

Sequencing Primer
(F):5'- TGCCAACACCCCAGGAGG -3'
(R):5'- CGGGCGCACTTCAAGAG -3'

Posted On

2015-07-21