Incidental Mutation 'R4506:Mvb12a'
ID332017
Institutional Source Beutler Lab
Gene Symbol Mvb12a
Ensembl Gene ENSMUSG00000031813
Gene Namemultivesicular body subunit 12A
Synonyms
MMRRC Submission 041584-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R4506 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71542922-71548085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 71543459 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 86 (A86S)
Ref Sequence ENSEMBL: ENSMUSP00000148449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034272] [ENSMUST00000212326] [ENSMUST00000212954]
Predicted Effect probably benign
Transcript: ENSMUST00000034272
AA Change: A86S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034272
Gene: ENSMUSG00000031813
AA Change: A86S

DomainStartEndE-ValueType
Pfam:DUF2464 8 259 2e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212234
Predicted Effect probably benign
Transcript: ENSMUST00000212326
AA Change: A86S

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212659
Predicted Effect probably benign
Transcript: ENSMUST00000212954
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Anapc4 A T 5: 52,835,730 N61I possibly damaging Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Fgfr3 A G 5: 33,729,999 T221A probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ip6k3 A T 17: 27,145,180 L298Q possibly damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr393 A T 11: 73,847,695 C143* probably null Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc7a5 A T 8: 121,887,495 probably null Het
Slc7a9 A T 7: 35,453,420 T88S probably damaging Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Tomm34 C A 2: 164,054,372 probably null Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Vmn2r23 A T 6: 123,702,925 Q35H probably damaging Het
Wdtc1 C T 4: 133,308,819 V137M probably damaging Het
Zfp276 G A 8: 123,264,927 probably null Het
Zfp90 C T 8: 106,424,864 P403L possibly damaging Het
Other mutations in Mvb12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Mvb12a APN 8 71545302 missense probably damaging 0.99
R0265:Mvb12a UTSW 8 71547010 missense probably damaging 1.00
R0848:Mvb12a UTSW 8 71545778 missense probably benign 0.06
R4505:Mvb12a UTSW 8 71543459 missense probably benign 0.13
R6834:Mvb12a UTSW 8 71545252 missense probably benign 0.03
R7809:Mvb12a UTSW 8 71545662 missense probably benign 0.21
R8289:Mvb12a UTSW 8 71543059 critical splice donor site probably null
R8297:Mvb12a UTSW 8 71545244 missense probably damaging 1.00
X0058:Mvb12a UTSW 8 71545835 missense probably damaging 1.00
X0067:Mvb12a UTSW 8 71547576 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGCCGGCTACTTCCTGTG -3'
(R):5'- ACAGGTATGCCCCACTATGC -3'

Sequencing Primer
(F):5'- GGCTACTTCCTGTGCCTGAG -3'
(R):5'- TGAGATAAAGGCCTCACTCTGTAGC -3'
Posted On2015-07-21