Incidental Mutation 'R4506:Zfp90'
ID 332018
Institutional Source Beutler Lab
Gene Symbol Zfp90
Ensembl Gene ENSMUSG00000031907
Gene Name zinc finger protein 90
Synonyms KRAB17, Zfp83, NK10, Nk10 expressed protein, 6430515L01Rik, Zfp64
MMRRC Submission 041584-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R4506 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 106415327-106426598 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 106424864 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 403 (P403L)
Ref Sequence ENSEMBL: ENSMUSP00000148744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034382] [ENSMUST00000212606] [ENSMUST00000212874] [ENSMUST00000213045]
AlphaFold Q61967
Predicted Effect possibly damaging
Transcript: ENSMUST00000034382
AA Change: P403L

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034382
Gene: ENSMUSG00000031907
AA Change: P403L

DomainStartEndE-ValueType
KRAB 14 74 4.83e-40 SMART
ZnF_C2H2 208 230 1.38e-3 SMART
ZnF_C2H2 250 272 2.75e-3 SMART
ZnF_C2H2 278 300 3.83e-2 SMART
ZnF_C2H2 306 328 1.13e-4 SMART
ZnF_C2H2 334 356 2.09e-3 SMART
ZnF_C2H2 362 384 3.16e-3 SMART
ZnF_C2H2 390 412 1.6e-4 SMART
ZnF_C2H2 446 468 1.92e-2 SMART
ZnF_C2H2 494 516 3.69e-4 SMART
ZnF_C2H2 522 544 5.59e-4 SMART
ZnF_C2H2 550 572 1.28e-3 SMART
ZnF_C2H2 578 600 1.28e-3 SMART
ZnF_C2H2 606 628 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211958
Predicted Effect probably benign
Transcript: ENSMUST00000212606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212866
Predicted Effect possibly damaging
Transcript: ENSMUST00000212874
AA Change: P403L

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000213045
Meta Mutation Damage Score 0.1108 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc finger protein family that modulates gene expression. The encoded protein derepresses the transcription of certain fetal cardiac genes and may contribute to the genetic reprogramming that occurs during the development of heart failure. Genome wide association studies have identified this gene among ulcerative colitis risk loci. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Anapc4 A T 5: 52,835,730 N61I possibly damaging Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Fgfr3 A G 5: 33,729,999 T221A probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ip6k3 A T 17: 27,145,180 L298Q possibly damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr393 A T 11: 73,847,695 C143* probably null Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc7a5 A T 8: 121,887,495 probably null Het
Slc7a9 A T 7: 35,453,420 T88S probably damaging Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Tomm34 C A 2: 164,054,372 probably null Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Vmn2r23 A T 6: 123,702,925 Q35H probably damaging Het
Wdtc1 C T 4: 133,308,819 V137M probably damaging Het
Zfp276 G A 8: 123,264,927 probably null Het
Other mutations in Zfp90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Zfp90 APN 8 106424150 missense probably benign 0.00
IGL02170:Zfp90 APN 8 106419524 missense probably damaging 0.99
IGL02818:Zfp90 APN 8 106424209 missense probably benign
R0378:Zfp90 UTSW 8 106425506 missense possibly damaging 0.69
R0462:Zfp90 UTSW 8 106425260 missense possibly damaging 0.89
R1555:Zfp90 UTSW 8 106424095 missense probably benign
R1869:Zfp90 UTSW 8 106419123 missense probably benign 0.00
R1870:Zfp90 UTSW 8 106419123 missense probably benign 0.00
R2110:Zfp90 UTSW 8 106425488 missense probably damaging 1.00
R2112:Zfp90 UTSW 8 106425488 missense probably damaging 1.00
R3717:Zfp90 UTSW 8 106424050 missense probably benign 0.12
R5288:Zfp90 UTSW 8 106425368 missense probably damaging 1.00
R5691:Zfp90 UTSW 8 106425078 nonsense probably null
R5789:Zfp90 UTSW 8 106423973 missense probably benign
R6283:Zfp90 UTSW 8 106425394 missense probably damaging 1.00
R6560:Zfp90 UTSW 8 106415747 missense probably damaging 0.99
R6977:Zfp90 UTSW 8 106425316 missense probably damaging 1.00
R6977:Zfp90 UTSW 8 106425317 missense probably damaging 0.99
R7040:Zfp90 UTSW 8 106425009 nonsense probably null
R7196:Zfp90 UTSW 8 106425148 missense probably damaging 0.99
R7523:Zfp90 UTSW 8 106423913 missense probably benign 0.07
R7535:Zfp90 UTSW 8 106424268 missense possibly damaging 0.94
R7546:Zfp90 UTSW 8 106424691 missense probably benign 0.22
R7719:Zfp90 UTSW 8 106419093 missense probably damaging 1.00
R8036:Zfp90 UTSW 8 106419128 missense probably benign 0.21
R8056:Zfp90 UTSW 8 106424480 missense probably damaging 1.00
R9370:Zfp90 UTSW 8 106419159 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCATTCAGGCACAGCAC -3'
(R):5'- TAGGAATTCTCCCCAGCGTG -3'

Sequencing Primer
(F):5'- TTCAGGCACAGCACGTCCC -3'
(R):5'- TGGAGCCTCTGGTGCTCAG -3'
Posted On 2015-07-21