Mutagenetix > Incidental Mutations

Incidental Mutation 'R4506:Zfp90'

332018

Institutional Source

Beutler Lab

Gene Symbol

Zfp90

Ensembl Gene

ENSMUSG00000031907

Gene Name

zinc finger protein 90

Synonyms

KRAB17, Zfp83, NK10, Nk10 expressed protein, 6430515L01Rik, Zfp64

MMRRC Submission

041584-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.155) question?

Stock #

R4506 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106415327-106426598 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 106424864 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 403 (P403L)

Ref Sequence

ENSEMBL: ENSMUSP00000148744 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034382] [ENSMUST00000212606] [ENSMUST00000212874] [ENSMUST00000213045]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034382
AA Change: P403L

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000034382
Gene: ENSMUSG00000031907
AA Change: P403L

Domain	Start	End	E-Value	Type
KRAB	14	74	4.83e-40	SMART
ZnF_C2H2	208	230	1.38e-3	SMART
ZnF_C2H2	250	272	2.75e-3	SMART
ZnF_C2H2	278	300	3.83e-2	SMART
ZnF_C2H2	306	328	1.13e-4	SMART
ZnF_C2H2	334	356	2.09e-3	SMART
ZnF_C2H2	362	384	3.16e-3	SMART
ZnF_C2H2	390	412	1.6e-4	SMART
ZnF_C2H2	446	468	1.92e-2	SMART
ZnF_C2H2	494	516	3.69e-4	SMART
ZnF_C2H2	522	544	5.59e-4	SMART
ZnF_C2H2	550	572	1.28e-3	SMART
ZnF_C2H2	578	600	1.28e-3	SMART
ZnF_C2H2	606	628	2.4e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211958

Predicted Effect

probably benign
Transcript: ENSMUST00000212606

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212866

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212874
AA Change: P403L

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000213045

Meta Mutation Damage Score

0.1108

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc finger protein family that modulates gene expression. The encoded protein derepresses the transcription of certain fetal cardiac genes and may contribute to the genetic reprogramming that occurs during the development of heart failure. Genome wide association studies have identified this gene among ulcerative colitis risk loci. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Mar 2015]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,261	P137T	probably damaging	Het
Abcc5	A	T	16: 20,333,695	I1367N	probably damaging	Het
Ace	T	A	11: 105,976,666	L152Q	probably damaging	Het
Adam19	G	A	11: 46,118,444	D232N	possibly damaging	Het
Anapc4	A	T	5: 52,835,730	N61I	possibly damaging	Het
Ap5m1	T	C	14: 49,073,761	V96A	probably damaging	Het
Atr	T	A	9: 95,865,237	C191S	probably benign	Het
Carmil3	GGACGA	GGA	14: 55,499,476		probably benign	Het
Cnot6l	A	T	5: 96,086,174	V326E	possibly damaging	Het
Fcer2a	A	T	8: 3,688,603		probably null	Het
Fgfr3	A	G	5: 33,729,999	T221A	probably damaging	Het
Gm6632	C	T	5: 59,054,478		noncoding transcript	Het
Gm8909	A	T	17: 36,161,480		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Ip6k3	A	T	17: 27,145,180	L298Q	possibly damaging	Het
Itpr1	A	G	6: 108,432,686	D1727G	probably damaging	Het
Kdm2b	T	C	5: 122,888,625	T589A	possibly damaging	Het
Krtcap2	A	G	3: 89,246,256		probably benign	Het
Map3k13	A	G	16: 21,922,178	S752G	probably benign	Het
Mvb12a	G	T	8: 71,543,459	A86S	probably benign	Het
Nktr	T	A	9: 121,748,883		probably benign	Het
Olfr160	C	T	9: 37,711,464	V272I	probably benign	Het
Olfr393	A	T	11: 73,847,695	C143*	probably null	Het
Parp4	T	A	14: 56,652,304	N1847K	unknown	Het
Pcdhga8	G	C	18: 37,816,763	V411L	probably damaging	Het
Piwil4	T	C	9: 14,725,963	T352A	probably damaging	Het
Ric8a	A	G	7: 140,858,516	I223V	probably benign	Het
Slc25a51	C	T	4: 45,399,768	V141M	probably benign	Het
Slc7a5	A	T	8: 121,887,495		probably null	Het
Slc7a9	A	T	7: 35,453,420	T88S	probably damaging	Het
Tbrg1	T	A	9: 37,654,395	E87V	probably damaging	Het
Tnfsf4	T	C	1: 161,417,174	S145P	probably damaging	Het
Tomm34	C	A	2: 164,054,372		probably null	Het
Trpv3	A	G	11: 73,295,324	N647S	probably benign	Het
Upf1	G	A	8: 70,337,566	R637C	probably damaging	Het
Vmn2r23	A	T	6: 123,702,925	Q35H	probably damaging	Het
Wdtc1	C	T	4: 133,308,819	V137M	probably damaging	Het
Zfp276	G	A	8: 123,264,927		probably null	Het

Other mutations in Zfp90

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01753:Zfp90	APN	8	106424150	missense	probably benign	0.00
IGL02170:Zfp90	APN	8	106419524	missense	probably damaging	0.99
IGL02818:Zfp90	APN	8	106424209	missense	probably benign
R0378:Zfp90	UTSW	8	106425506	missense	possibly damaging	0.69
R0462:Zfp90	UTSW	8	106425260	missense	possibly damaging	0.89
R1555:Zfp90	UTSW	8	106424095	missense	probably benign
R1869:Zfp90	UTSW	8	106419123	missense	probably benign	0.00
R1870:Zfp90	UTSW	8	106419123	missense	probably benign	0.00
R2110:Zfp90	UTSW	8	106425488	missense	probably damaging	1.00
R2112:Zfp90	UTSW	8	106425488	missense	probably damaging	1.00
R3717:Zfp90	UTSW	8	106424050	missense	probably benign	0.12
R5288:Zfp90	UTSW	8	106425368	missense	probably damaging	1.00
R5691:Zfp90	UTSW	8	106425078	nonsense	probably null
R5789:Zfp90	UTSW	8	106423973	missense	probably benign
R6283:Zfp90	UTSW	8	106425394	missense	probably damaging	1.00
R6560:Zfp90	UTSW	8	106415747	missense	probably damaging	0.99
R6977:Zfp90	UTSW	8	106425316	missense	probably damaging	1.00
R6977:Zfp90	UTSW	8	106425317	missense	probably damaging	0.99
R7040:Zfp90	UTSW	8	106425009	nonsense	probably null
R7196:Zfp90	UTSW	8	106425148	missense	probably damaging	0.99
R7523:Zfp90	UTSW	8	106423913	missense	probably benign	0.07
R7535:Zfp90	UTSW	8	106424268	missense	possibly damaging	0.94
R7546:Zfp90	UTSW	8	106424691	missense	probably benign	0.22
R7719:Zfp90	UTSW	8	106419093	missense	probably damaging	1.00
R8036:Zfp90	UTSW	8	106419128	missense	probably benign	0.21
R8056:Zfp90	UTSW	8	106424480	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTCATTCAGGCACAGCAC -3'
(R):5'- TAGGAATTCTCCCCAGCGTG -3'

Sequencing Primer
(F):5'- TTCAGGCACAGCACGTCCC -3'
(R):5'- TGGAGCCTCTGGTGCTCAG -3'

Posted On

2015-07-21