Incidental Mutation 'R4506:Slc7a5'
ID332019
Institutional Source Beutler Lab
Gene Symbol Slc7a5
Ensembl Gene ENSMUSG00000040010
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 5
SynonymsTA1, D0H16S474E, LAT1
MMRRC Submission 041584-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4506 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location121881150-121907694 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 121887495 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045557] [ENSMUST00000127664]
Predicted Effect probably null
Transcript: ENSMUST00000045557
SMART Domains Protein: ENSMUSP00000041557
Gene: ENSMUSG00000040010

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:AA_permease_2 51 481 4.2e-65 PFAM
Pfam:AA_permease 56 489 1.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183015
Meta Mutation Damage Score 0.9594 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation die prenatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Anapc4 A T 5: 52,835,730 N61I possibly damaging Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Fgfr3 A G 5: 33,729,999 T221A probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ip6k3 A T 17: 27,145,180 L298Q possibly damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr393 A T 11: 73,847,695 C143* probably null Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc7a9 A T 7: 35,453,420 T88S probably damaging Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Tomm34 C A 2: 164,054,372 probably null Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Vmn2r23 A T 6: 123,702,925 Q35H probably damaging Het
Wdtc1 C T 4: 133,308,819 V137M probably damaging Het
Zfp276 G A 8: 123,264,927 probably null Het
Zfp90 C T 8: 106,424,864 P403L possibly damaging Het
Other mutations in Slc7a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02192:Slc7a5 APN 8 121886390 intron probably benign
R0364:Slc7a5 UTSW 8 121885015 missense probably benign
R0580:Slc7a5 UTSW 8 121885116 missense probably benign 0.21
R0965:Slc7a5 UTSW 8 121907101 missense probably benign 0.01
R1274:Slc7a5 UTSW 8 121883714 missense probably benign 0.44
R2135:Slc7a5 UTSW 8 121883705 missense probably null 0.96
R4163:Slc7a5 UTSW 8 121888400 missense probably benign 0.00
R4910:Slc7a5 UTSW 8 121885122 missense probably damaging 0.96
R5243:Slc7a5 UTSW 8 121896535 missense probably damaging 1.00
R5449:Slc7a5 UTSW 8 121886348 missense probably damaging 1.00
R5719:Slc7a5 UTSW 8 121883642 missense probably benign 0.00
R5744:Slc7a5 UTSW 8 121888382 missense probably benign 0.00
R7473:Slc7a5 UTSW 8 121888423 missense probably benign
R7499:Slc7a5 UTSW 8 121883722 missense probably damaging 1.00
R7663:Slc7a5 UTSW 8 121887535 nonsense probably null
R7680:Slc7a5 UTSW 8 121907267 missense probably damaging 1.00
R7682:Slc7a5 UTSW 8 121907140 missense probably damaging 0.99
R8382:Slc7a5 UTSW 8 121885952 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGCATACCCTAGACAAGTC -3'
(R):5'- TAGAGTGAGGAGCTGGTTCC -3'

Sequencing Primer
(F):5'- TAGACAAGTCCCCTCCAGCTG -3'
(R):5'- AGGGCTTCACATCCTGACTGTAAG -3'
Posted On2015-07-21