Incidental Mutation 'R4506:Zfp276'
ID332020
Institutional Source Beutler Lab
Gene Symbol Zfp276
Ensembl Gene ENSMUSG00000001065
Gene Namezinc finger protein (C2H2 type) 276
SynonymsD8Ertd370e, D8Ertd377e
MMRRC Submission 041584-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R4506 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123254195-123269745 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 123264927 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001092] [ENSMUST00000035495] [ENSMUST00000127664] [ENSMUST00000154450]
Predicted Effect probably null
Transcript: ENSMUST00000001092
SMART Domains Protein: ENSMUSP00000001092
Gene: ENSMUSG00000001065

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:zf-AD 79 159 1.2e-13 PFAM
low complexity region 402 422 N/A INTRINSIC
ZnF_C2H2 434 458 2.24e-3 SMART
ZnF_C2H2 465 490 6.67e-2 SMART
ZnF_C2H2 496 518 1.38e-3 SMART
ZnF_C2H2 524 546 1.82e-3 SMART
ZnF_C2H2 554 577 4.79e-3 SMART
low complexity region 586 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035495
SMART Domains Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 78 100 N/A INTRINSIC
Pfam:Fanconi_A_N 167 520 3.7e-146 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 1069 1079 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
Pfam:Fanconi_A 1246 1308 8.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147312
Predicted Effect probably null
Transcript: ENSMUST00000154450
SMART Domains Protein: ENSMUSP00000119771
Gene: ENSMUSG00000001065

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:zf-AD 79 159 1.9e-14 PFAM
low complexity region 183 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211934
Predicted Effect probably benign
Transcript: ENSMUST00000213090
Meta Mutation Damage Score 0.9597 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Anapc4 A T 5: 52,835,730 N61I possibly damaging Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Fgfr3 A G 5: 33,729,999 T221A probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ip6k3 A T 17: 27,145,180 L298Q possibly damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr393 A T 11: 73,847,695 C143* probably null Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc7a5 A T 8: 121,887,495 probably null Het
Slc7a9 A T 7: 35,453,420 T88S probably damaging Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Tomm34 C A 2: 164,054,372 probably null Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Vmn2r23 A T 6: 123,702,925 Q35H probably damaging Het
Wdtc1 C T 4: 133,308,819 V137M probably damaging Het
Zfp90 C T 8: 106,424,864 P403L possibly damaging Het
Other mutations in Zfp276
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00726:Zfp276 APN 8 123258337 missense probably benign 0.01
IGL02573:Zfp276 APN 8 123264997 missense probably damaging 1.00
IGL02729:Zfp276 APN 8 123267816 missense probably damaging 1.00
IGL02956:Zfp276 APN 8 123254744 missense probably damaging 1.00
IGL03019:Zfp276 APN 8 123267934 missense probably damaging 1.00
R0087:Zfp276 UTSW 8 123265047 missense probably damaging 1.00
R0386:Zfp276 UTSW 8 123259503 nonsense probably null
R1084:Zfp276 UTSW 8 123254723 missense probably damaging 0.99
R4199:Zfp276 UTSW 8 123267825 missense probably damaging 1.00
R4584:Zfp276 UTSW 8 123268406 utr 3 prime probably benign
R4776:Zfp276 UTSW 8 123254884 missense probably benign
R4985:Zfp276 UTSW 8 123267907 missense probably damaging 1.00
R5017:Zfp276 UTSW 8 123264977 unclassified probably benign
R5018:Zfp276 UTSW 8 123264977 unclassified probably benign
R5115:Zfp276 UTSW 8 123264977 unclassified probably benign
R5116:Zfp276 UTSW 8 123264977 unclassified probably benign
R5412:Zfp276 UTSW 8 123255781 missense probably damaging 1.00
R5436:Zfp276 UTSW 8 123265282 unclassified probably benign
R5822:Zfp276 UTSW 8 123255718 missense probably benign
R6059:Zfp276 UTSW 8 123267823 missense probably damaging 1.00
R6186:Zfp276 UTSW 8 123255933 nonsense probably null
R6947:Zfp276 UTSW 8 123254904 missense probably benign
R6975:Zfp276 UTSW 8 123256831 nonsense probably null
R7313:Zfp276 UTSW 8 123267823 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAAGAGTCAACTGCAAGC -3'
(R):5'- ATTTAAGCAAGGGGCCGACTC -3'

Sequencing Primer
(F):5'- CTCTGGTAAGAAGAGCGA -3'
(R):5'- CTTTGGGAAGCCTGCACATG -3'
Posted On2015-07-21